/%PDF-1.3 % 4 0 obj << /Length 5 0 R /Filter /FlateDecode >> stream xWnc7 ߯)E[fAMcy4NCxaH򈢟薞'5>d:J"N~tu̴y&.8ȇrpzYv х'T^ߑVv'Ww׀_Livئ̓x:rl|QCJHOҰ~J.OD5;dĨu(DX.!ֆlG## c7Y-d zLx%&# C&!o)8sb{ޖJѴz="# т15}ʴ(Os&fe퍈+Bf"hd 9%"3g3'\agl5$cWgBۈG 9 :7 b1֤B)f kBq$B2<[ȎH^/LU3/fƙ#7LYd^DGjDӷ05HD-Kl9"#9aPûk4O٨,iޑ4"``uv Hc؀\_H U:F'霆~M- %GMZXiu}! Bj{oWx6`ZQĦ ^d%o? FwHB:/O _Y=`inH6F:Zؤ!-]k][!E9ƫXsKH&inZ=VמԾ>، WQHYE& !Np7v&gѷ ч2 61[c2/o(tr=07%PA;x221`{fB c!zg 9 )6/u+ |dO( A,8m5frkmgQi5mqr5;xO"#,+]8c*H>X̂D6-1L`k!C  مV$j;0xX"Gp|:Wr]ZXPL jЇٓA~J$S,ܣ -Nv٠Vڙ2@\:rkhgkYlsM+_7k.tdTV!=rC5,^.s{Wi+^4m̘zII c\ p!C%֮oZkEoze]}흸=zFiWwvC2켔Cj쩽| t08莣4LXr: UO|LbHKrp] endstream endobj 5 0 obj 1361 endobj 2 0 obj << /Type /Page /Parent 3 0 R /Resources 6 0 R /Contents 4 0 R /MediaBox [0 0 842 595] >> endobj 6 0 obj << /ProcSet [ /PDF /Text /ImageB /ImageC /ImageI ] /ColorSpace << /Cs1 7 0 R /Cs2 8 0 R >> /ExtGState << /Gs5 22 0 R /Gs1 23 0 R /Gs4 24 0 R /Gs2 25 0 R /Gs3 26 0 R /Gs7 27 0 R /Gs6 28 0 R /Gs8 29 0 R >> /Font << /TT3 21 0 R /TT1 9 0 R /TT2 20 0 R >> /XObject << /Im2 12 0 R /Im4 16 0 R /Im3 14 0 R /Im1 10 0 R /Im5 18 0 R >> >> endobj 12 0 obj << /Length 13 0 R /Type /XObject /Subtype /Image /Width 349 /Height 202 /Interpolate true /ColorSpace 8 0 R /Intent /Perceptual /SMask 30 0 R /BitsPerComponent 8 /Filter /FlateDecode >> stream x]UWҋ i,Xb|/؂gEHG)AJ%6DP9g-wea=$c l[-` l[-` l[-` l[-` l[-` l[-` l[-` l[-` l[-#24 xcXA/Xa1q q_`Pp ͫ[n2,333+++-W[#`aڵ۫N>`U˖-KNiJX<1x':ZlӧOOt騟c$,k H2$45j$b ,HhaqmJh[n39FhOMTdqN;-5 ׯ]_50(^_]EԩS'kݺ6OصkW,j}_c$ ,@~hѢ`qceox)g8SjM6bd 5U@yZ a}xkN 'aeXp@.ݸqc-&\KH-qXM:uwp a<4pꩧ<ܔ'0&,f3.봀uA5lPgS"r ~x5M4>;Y&bj`E{FhCFFƏjTIyxKux渱@$O/X7 ;`5USJgD2WՁ.\=\ZUqǶE"ޚSo4eӝL,)O[srBEDSV[e;& 4 ~y/ Ԯ{"}ak׮0pxƕjg=&.kFU|BȏZT󪜢-cGDZLk_o*ENy!"oΏ8@ GdFǢܿk4 |EU'gB+1%-#\B,9LNE޷(Y;K+ 26B7|u7i *_.nwc&OmMtt=S Be1[YYE'#ScQP PswP`P||Al?XTQC'|89eG%!@x G߷no>OeiTw0ݤHN$6NGXP6y}W^RwqaBIүyFT.^ilBR e R) VsccQ둓lOQ`o,ɱ玊V(YWAED,'v"`s?t{J 5yrcxbh*wQ[1U? 2 h1эҕ->"%ʙ[-bX@О*7޵ˍX*':X(ygr3jX(x=j#UHmy"?PPg,/Vʾ-fX=pw.B+Vk sŘvi B W [(G 1M{FfGEf`*[(\y'-\s/6bC4ÂK'45oޜp@$V^VѾ7PV-U9pvl,:FSyw*X',*s&5݂C{U7-wK0 9bQE7'v>u D|aApFpblh-&òg;M9 T/rg^qTWV,5ЊVa8  eWd郲$1qeE _\&i^|aAm8v#2 ҹ҄ ҥi"]%B  ,@#ѥG6@9mljTZPݪO5,d BU]Y s$3Q)v8ҽ8,@\2,W/xn=qa1B{*AEF ԗ(J7YHU†&P% 9^.]Pn ˖-sզ ݸV1s^8RC _CvXP-inM6X`,*X0qOL X(4F#FpEQn wpN"=/ z\d`g9XV1a„h UBE٣ٟR{gÍ,b$_E` b%_vDX(jBU|M4癳,4@N}bǤj{TX?{u=*'y.ҥDTR$X5=$.`}޼y5IF <`=SIjX $f_"ED5,KJja!\,wj[aFհ.\Uajԭ^`E&MkAlRlh6ݖR,T={v\79!,m0L HǏO\fLtDX(xv/X((݌,n ~JD`ʰ0SH'Il=TE beGR€sFtx饗4!f͚ť/xBDK8(l ~>JǩؕEj os @Xcm[r'PS" %X(6tvvhRρp#Ab a3\R&BE~ᷫ89, A]wXՊљ/Y Zɴ?l/#EAתU#y<*}}WH 2UZ(a^H6 *G H@`L\'EQɛǿUX*ꬢiZZ,@㽜 npQ80V1G3-*3%OPaVU&sh+[(/9d.ywyΤR(`4`T|/iK+[(/>}{_O*S)4Z=` w.>kjX[FfnVD _ k$Dy+f`(/̙beQQ܉XEtNm[P壃ֲPilAm]`LI/?* K4,5#BHUE9!RFl̆§p{-,вKU?*:ڔ'A5 /Q& IxMCLta-8h#m Ve5ƓRC1MRdJN’bZ bאg:Q9Hc+␣nEqwnA؜HKJ Eb@W-7^z-* 57ܬA"蜉]Qu;pBaK3qӼÌ3|Qw38mR@v _u  p,@~K AH<( ksg +%[@a,'M8TDDeY)Ȕ8UJ>X‰huC套^*D6O´?C׮]E1 )w irT&`vr`ZǘS09 uhfOa'r,$ OW_}5"1}`"צ55U9Ӽ'J.y/uٻ&uO0yEHV:/~#-&xaA.j҂ouّ{n/1= 1A "hG 4l~*,xف:IX,-@k`2+\ @c"YC'k? ޙwPB̄?-01u#]-.;5 SLQ9` \tru;m,  @/˞.@ɓ'`гi-|lTcctJ{o $:oe.7rm csQ[v.˾w~Ax#'!%㽠[e—ț6H 妳Gd|w-02eZX0m`U.`@ Ed(;:OU X>?m:F1gL}^zyi|.-lDo[[ D3ƴ:J,'(.qf +;ˎL8ہD@@r &Z-P).K V?}$ST13 Gm(<pI}F8 -֋nio ;.VYrK#ƱٛuÅ$|| <Ò۷O9q "&0lOE*RB"eܪ?I!k/hUr ^{[s3c =;ڜ&QZ p@$LgޭZdٳwL0fV0(@/MpՖ'%L$a+mлw译" 6Z7e l]Y؍^1n;F })B8 э'"tDG xɌ=/p3\s*ɣ`BS0ƫ<𘰄!kWhW77sM6h8Q=3P$0t;εPF w\ilI5C{@Ł}ϖ|/  L9&`HAz  -T[C&%(,.j]j#Q s[ izXK&(Qo9JBGYUWx`/wvZJxgj33F $L98 \Ц e뮻N,M4P%{nH*}/Y~eLM0? $WMs(ў_k',Y$ 9h7oMtMb(» FvTj)#6W%s/Cli $&y",snﵷ53Ubph%nׄ7wzsҨUŸ?X_d鮶P*&Xܲe6gӄ `O5('ME)#'=:LJ ,\K,B=AvvNI}Lw`pϞ=Zd?^ic!"RgX tP-[?>$tE|%jά q@ KXx{S,lS ބUӬe <#bqΈ:8tZ1 XFT]{PS'@gL8;$sf7Y7` ~.Q!^hD{3I`8ïzvkpͭX&0 ^7j&%h7qԶm[-&iMn XOF–;Dԏ=",ЃB.@#-qFx-{GC"q^$1xlDXwo#)0~cŏo@",,I~,ka*:)>lgpx0<{ q׈+ .c7tHqֿ֖(KPX`Кg~іyɚ^tÞ" 6MFnǎj7 >Rae̺I^x@-x/:@ "X`@hzg-caVsA01xBD qQXeq @RagahC/9 U ص.ɭF2i ഛ6mҎ@$tΝy y7L7ވ02.f a e 3hs}=ȣI45.yX2:XxoٯDjʑ ު% wq7XK2ZT1 M{: ~3g%7oq 0z`m$B7(sZ~6QUQ`giIgrK9_Bs\7)[1FSCXXf zwI +8;-`a2a t¡bŕNyMҖWf2% &64x}`ObHSX7؇Kb0sLo"P[ }a-/Y& 3H_XȬa]nӺΥ,c箙,еkK'ن:tp,hc ),оͻSw'q38:>:Y@5/s|otnݺ\;!ç마ӗ,|Ai =Z/]l$־7)ܲ3 :,1O zڴi?r jYFoߞ<: > DBZ,t"&30,t"BSLQs&QsnL[ -`3$ŋݴ?@,fwZ xL> stream x]ْu- ?z-H7q'E4)SprX C e#?> snfVvwU̻:]v{x=[)%;7oOe'ԵSBowׂWz~f7wNё;'1vt_8+[DJ $47/9z?Lvv~˰ 8pY8h~Ag7sq^b;y^gӌP{\}QЦ4#}UM3B%oZrh7n,~/BoqYCٗ,ɦa5L;vG& lh㩾ֿqtF]}p\LWo^e"msӊƃm \* O-tnfZ&௮ Tu.ޢM?BGj*/&t;=WaՌ9&->]L^qt.- T/b+r&xwi|0^,{2<%H)51Ej` _5)K(dč3( 6m &sO~1̗WZzG04#=sӊow#\u}w"M {;GݛՂS8 #C g4Te ϫGi 8 6iޗ,^8 pc\24#T燿 Ŕoܳa1&anIQvhg_:]ӽ0NyM``K? /'C9;Y5 } YX}v&dM%ՔO 9yiaMʧ6N˴lޅ|Iƫ|b==wo;\U[pmlL;}N?fޚ>j#v|(#?Aqe]O# 6J~J0hoڪ\HiܦiU8#x+JJj˻ WTՒ`SKfli2lRٔKcƦɰMxd=M 5bMᶀՄl^~7M+_&B10FiTjMS$$l^|{Mkz3Ii$`ԽA šqٴ[@ 42VjT6%#iM ߛbOw%5GcSZExFaR ol`qԽH.v 6-ՈF=UMs_)scSfӺEeSv5M ɠl^X볒: Rn46~86u~cp8 Z46c@lZgjM5EiMݷ^,-ϦX&B14o>v_M_@ش zs.Ǧa6|u}cdóo|w4 06lG¢lڬk%"lD(bz>Z ljM lɲ#|lZY+iljy9ٴ | &vxx( ;^|P<>1vZN&i*#(G_#&lF%1%PTBW4cQbb4)汦M܏VV#׳1aܸsP꽴䷉M-ErR&c 2;y$wP_>˗aҸbc`.nU l{{{Gez9 ENJbX7$ }8L=7!Ћf1+iM腴75Jv,>Y|G8#HzRwBZZƢ8 R$ l{7۩nMJ,_awз[!G8j1:%d. Î?ĒIQٔHgyzgv%$PS&r&wjKK Y<T!рoT'sBtKd\mgVb"YZQ08⡬!,X5żMRY%DZ=NOuW]A5)s{GlQRlQ^i&~7|fG1OZYap6E|rW4pJ/̤N<ɁQW<%+AZ}/!-x&/gh$>ZLMfS; $1@P^>& X5eZ#yC{(9۸oÇA}[{d%l(لxz`2^cD-HAQbb4M&:d$6!I-&_/ҰWV&Lke і7) DPLΨn@tN&lBX' s5OyY L3=@؄X[ypXri!.D *c|4%'<ǭH1<pEyy $"CQj|~rѧbkdL6+)ǟ7J^U-zSt)dvMm2fQ'WzL4A }T3?B} 4e1T@vG~Z^6şG AMo!քYrIBqASNV||U+3ul1+p|y1Wx[E79apOF$JˢȔբ9IA*D d>"nxo@!aא$.!je6p*!drlbu(pB?XΨ? ^q e{r P8Ox15&o;'x݄ޏNg}i<^I&M|Y|0#(@"3Os%zoޕՓMh›m2d:'.Kdbm X%Ek#@l-pD s|(k~?I6qNDI2C/! a 5etFs*+]Iɚ"xwCbtUB5 oE?L/"ǎ~ +x6yMeQ`,~, _MwR)s 8H5*dSC: GWaϗ2(T`PȓPW4ԧjFFs ƙI B7 ]7?b"/Ɠj$+J* j1UjȦ;OX̄[)y۹96oXe%hosDMZ鐇T3>bEu&q0H412`*1Z pбͩdJȦScqM*j 5dS&91@ 2>82.=5ޞ^[p9SIkF1jx]@ !&::L)j 1-^P* lbw 4gWԙM9c&Y&E5~:*&NMI?m-mM/Y[!Z?0XeWϲӐfMg^ Qj"I1k&c$Jt̜cJWtR)!Z晿_@Mh*g;D5uZ@zRwnU'gl:YJyD3&UXJDA2OԸ%leGUt7d ^gEstCnBz7qmw&|X2d$AM:}fB;T1+Aj ~M?"EG 6ɝ\h&QEHQVYH%/\IJ"歏cFHF?v_áa"u{ IBfԣX& \,(LH@g-ptt`ޡFN}tMz@%; M8Ģ>U be q?hs)p@9yK/94fTɈ8$1ypDDb&1ۅuǒĿV؊ V endstream endobj 17 0 obj 8060 endobj 14 0 obj << /Length 15 0 R /Type /XObject /Subtype /Image /Width 260 /Height 188 /Interpolate true /ColorSpace 8 0 R /Intent /Perceptual /SMask 34 0 R /BitsPerComponent 8 /Filter /FlateDecode >> stream x]wGMb[ջXM  [H.Q0p?^~yq~~Vo߶liH~_vm_a ӓN-yt᏷߿ 4gKMdVU8f9=3pW&?z9dl'y,xU"sR?>V9j~}J]YHgjMws|bt%\#+[iG~]l_, ˷xW~Nx_nxw2ڈ<#bgn{/%˫lf|`yT[ޙǹ{2WpuqQ>?:"!<^!vwwݞMo.߾}C8=9ݜW[CF_Vlh;e+=~uWiS^C0[5'Lc}?\Įx]4I8biu[CZLX~1sqt}ONN&Φ{M3㏒\b a|ی ,{M>?_FG& V~ܦo|>1'xz&O}jZaExEhh+b˿[OjTS,VOk>&3b)annhؐ Uzj1Wkm}z>Й*ʐ#%!q.?͍Ǹ>ɓf%#%>mtʪպta8炤u~:I9Ap~z,W6-!CB‰:ϥ^!qq{ 9$96ŻKr;ϙ`҈&X[s>jiG 4fo_F8`]m:φ>3 ACW &s1WX E2hP$gV4{tr3'1EZ+#VSVCg+(U3%6,{ɔ<2j?NT t QkUJ>pVI›/Uﮏ_QL8UB e]ZVq%9 9BS U)x>bhۚh%w=~vyHXǍJyrjIIUI1v"iUp DjNRx8Gj)K&_r[=X/M 7HDŽ@oپPۯqkgBgZ_Mk)[mg#B|EJK8fa;Ca8 X\>y!_ܺ9vVZ/9g w$vkNj:VU2cʆ*b/-.߈a|&RvYE2B+MBza0VFQ\>c09||֪l~Bp8?AFf5ieUw[d1I}q9wwrj57o.H9@ƈ _h$G}:ݪzZ-G9h*ir"یKLg ,onr9ZRߝ(ϱ-rHHfOt&2}]8 ~7cLL!)x(>K5L-SG4Y: B_뒞HزuKz+3DGaRU,FXZ`hKLP1au׽piz1x)T9V iqC>*+iLʢi8Wooīҙ2"lEqIQ%2&f%!ni~bb.=48.uM"T06Wb$+tɄpC%]Bmnjp813oR47vl7<ͥ7S׌9a.ܾ_Ojt6uqcd6\b (xq}+F1[tG7ホa71N3F7!{2\o,m+ 09PqaZݡ~XntWF%#,|h ;S'"F7Wwf;g0]E2]ֺL+:[2 .\*.θ+v\ kQEɀ;HLN_\2Ta)*z*kF:龵ҍ!˜1$:|q6Qz6 &FCJOb&0Fezg"G3 K~$9jm77Ml  Ŧ;I)6w(EɘqmW̦6լCfnnfz73IjKTe+S֎k=@+MT]4f̏i C6"gRh6[(>-C.77A:m˪Qp}t>o;fp(.+I9fsn変Гwvo"k'i ]2\W3".k]U{zn͹QCvfMe U]nDN]1xQ[ c1cgtY51k4]nH?Cd#E3R9O+x5"Z]J&^&7@tD~\)Nr&X>Y/;ܨos{W|r&?X o}N7lb7 sp VQdb7X; t$..{Q,=q9w˵ú*1:J1vCjG14Öw7u3y-}6&bј~Qnwq%l>%]NLڪЎP77[[7) .ڜ" ?1$i^WZ'3EP={`{lf.QS0㙢yy'io]ԆHsٚiJn?܄K{Up!Zb4@UM)V{-0H3y3gRQ ϜZtJ/4b2pf@S4hݢQESuUruqQJ֘g>ϔ>;;!?LJQ0\KH|tyf`h"\|[߁ x; ő|g LBHToǺw~T<;gR]sjZג%'*%q&TfGme/ћ$*oJm7pUl = DIbA?OdNhj`e8}9(ƃd: S#ng@!0ԩu@$2І'jN&{, ?}O+TfǦŶ-pnFho;/i rrۻc"--;)\s[/SW *ɏ9t7 5c#&6 DˀL3N taqfQ~op:jZMX >hL,lvyU1ejuhl5n'1BP#'k|T%Ajb/1Zsx>ƪϦKg`_kN-E~ZJֈ&BM؉_~'Rxॹrm6γ}]jwou/*1Q մ2xvwg/3*k6)FQ_>x U]mc1C8%f,~x 85&n/UM72qʔD2ҠFJdI~Jk4ƓPt[sjwI ̀^/"~Gned!9TsxU91 >575r#f4&\6fVc!EI"2J.c48^ {8׊QylBY9c;&%n.o0=ԇ l8yI816]% o~ S$8x&v.,XFV,1*ߌ[$K*y&~k͡cuMS%\21j&叜0i1E2?'jńRQזsbP9N 5 Z]ͬc\6]K{pӨ+DVIbq:p1$bDD%knʅrpQ9 У4]-2huo,OhV ޣh"ђ3=Jc^X d>,uOcp567]яWs.>A4 :&.6DYpM3q]"P:ĺ Rɫg$݉LyC>.P9XS>qK䴜$Z?ZnNJp-<P[VyN k1n:xa׍-3<9w Y58& N1Cɕ^ZRHvm@22Sa3@@UDŀ8@ XL{flEɌZ< ZµQEeG1iTGfBaȀ`u?Z/w~^_\68!D@gK$mJd0H :K7qv| Io +Y~Ka:LizXلDg7Ԣ-@fI pp94`Ls6N,6Z']  I[CjQtڛE:E2 θ LBd)C-!а4]Lm$ՖB=QFnOF ILtQ?hSwD;ԥfq$k2|cV$[W$M4,Ql/3qYa2W99Z||Z˰YÔl+Apʒ,lD9B _;WxLFJ;g|澩xPf'( *35b՗"J$) oE R~@1В*wMߚ{!|og۝tS=<}եdx1^M-#v5"/qRU,C(9΁A3 &iC[V&!K՛7hsiLM7 i&r V4NlyH{7JEmn߈>| =VˤI;W$ʟnxk]"& WMZqLӗU n a˄ Ta4Nf!HFmQ Gʘ[<}u1_}23= C\ej:yte}E!PELimLUk4ӥE/ITf|i \𙹧:Ba`1k;ƾ1~5- qw6%)C&Vsf26p; ߽NJݡD`GZLa-挼;vD9{Lԭ¥9 LsC){ÊZskAþ`; Ahe+lZoC_[KtY8sDQhs2;T!&g*w^6kM}> a}6<%X4.`iAy T7,$nG8Rp.-ݜj{xd2{|kslb#&ZI$`m#43_߽i]s%ZJ&pj&h*PĞvp?MNhW4/bh_Z47}<(= &`/~&=LL\]:5]ݫ]} 8 {s|E3P^q֨h2A|\x+ j,3Xx_"&˱YkU|8YCk&B)v}wMtqcLT<ȴtʀyFG3 Nݓry$lv2E ]ȿb;1+]`Ń/wœ7ٜ`;Qeq͎PJLsǎߣg{~s4kqpcn;{\6U.r\\4} z{KEZǙ}<p`C!Gl`k:%rQ73u9H^L,pllamU]gL4v&cucy0Wgd'usWӓdi6zlrܣTy]ν'/n@uq:MA̮|eaׁ;V2/ Mpޒ؆=nnr> stream x콇cչ>}{/ے`lcBIHB7lKڢjc1qS٢U{϶yЊx<:;33"q6Xz pǘv>/_p8G @6@5"@o_W{b |"1XM c2J6G#pE@0`O0ڌ dflbdAp(U=)_p8GgF!9adhiO{?uD BR̤2gvs:uJb4W9G#"i+,r^:'$={}!yfg` 8d"M$((M~HHN0)xp8G 8|&*Π0{qQ.qr]I`3*J0#~"I`4 '*G#G`-'0$! 1j<&cx,@sxa؞938vpp0dI D_pbT%( c5bŜ,pQ#p8ۈ8#& i #ƈ]Yv`nzlK'QD\00LɈ 3-{;''D Xx}~~(G#pnxITB>X8 3e/P!0GD5le{:z{$r bc^vcfr,qoǾu/#p8AIplJh 0a!>{b@$5O cې?Ud ̍ C¸ *Ɛv" G#p8({ g@89\yS9_;՞/~̹]w߿{5G[~hMv"q<3x</<}Dsx(S{q (E"øV+a ̃7baB#Cݝdy JS¸ ۠};3#N[X+G#A@/ME%NmeEś mK6X7m[E 2,{~ַluW##?JD$<%B$BzT/, zp$'HߓZa?5:8x0겄 6rG AK@2 n%F8G#X[R$*l%ͥ[JRPt,vt"x\T46i F#HHB#(HozV |[0_6 9Lt".0zKG#R$*o0lml-X^hS#?ZXTn4o6Y9R[X'FAQz"H0&gԊTjX|%A$X@S[ya>(V8G#HT KXTf.IIJh}x$\T-Y7l:TxtC/Vl)\dl,*5=>G w ,F>D5q@"'I0A] @WZE I"Pt5'd/05 >hHvz8G#Xʢ+\h*ld4?QdʵNN>fcB0e F6-PD G%7UaOG#OT6 mJَ}KJ%Ga![5B!%[~i:B!(Pow'D(`&+Kخ`&aI"#$xΔ7p8G`Y~n*h*~|ӍJ[Kl~d6;mAϑ)m'G@B@W,0 +">K.,DNG#(V5\o6cxSaG )bH7Z|eIcD  ޸'N06@"'FvKKT 6-f띛a/p8G @(:Fgk竟o~sӧ:GOOqţ52[6YLu&,%閒-&˖BVcæ4-TXSfэEeX) lZҍBkJ- 5qΉ(1J0@F$!,>ɀ¥@3==Mf:Wh%sjl8p#/p8G`uP3$c!D+h1 P|x69:sXO*^?Sg' r"!c\gLvR#p85B$D> 8!߇Ą7 IxB`FQ_,Tvw}TmWG]a󱇋Xo:n\ؽ0 3kuATl! [Dvaɝ܆Op8#@ ;̅#^ٶG7Yo6Ͷt|X0XK߸p7Pe&d26[.Xg1?st@zC? _UYZ/ja[,z-d, 2;1B\E2BG#pV7&Ha?R[9 -O=O? ! p8P(D,ȕ>sr0 F‘O]x4QI3葢uF:[S&㱍?*( |@$N H p-NdbdODBQZynj"<G#p?x*}8p_?qDRph6Bau\Z}O Yכ.,HTJ7ZJ7ؒq.g} 8" /r%)_@B&b*?g*rD6 Yp8*"DB( ~w/\03T@NX%1_Z(l,CI PisK\W`{X葤DedAWLe3BƯ!XEN1!KP&cIUX ۚ ~x-~N#p8.Q2fHb#0 iya m $mySzPl_u͏h9iGm:Rf;-{N}<:%;)9L"ىQpp,%!`A fp8"D,̄pUP [+_3ƲՀ1`A(hD0FP09;ŋU+~(0oU1o-*XXZdK[Ŀa-Z"[iDY!-OJ J_G`-q9|G#p8`H` ={lɂ:~.UUUSSSLBR$0u׍?{$n*!"np8Bi[P01UsH9555?O?}g1ԅn`G   88(бcDOv&D,r! CAɠ~c6D~h)NhMpg~!%\|B/_a 02c* p(Ka$UOXE*$WI~#p8 4 ' ; @bC9S0 $X`2LØ ' '`{l οIR] b'\e,usW mEty iAT0d.AMطOv 8VZV"1s7 Z&BҕKD292Q< <.9G#X om@s𖮮.K d#(r` 8 E$ "2y31%+GA8 ^hk06BݳٖͥAřQ\ %wFLH6HǵFf0~b耜,q*G# {%8<[ O>pPQ@UByƏĖZ}$,'8r\%&qp ^DR:[."hm8p8݀X Z*L ~B%sلEJ2y $0ąmÕ6FTH2vaga |LVDZ__rO-[-[֝'N">E lERnثߋ*,JT@]ё\,G^p8]@BZFx*X d,%!NaB(^0dF8BQ dc2`pF^+%'em%!ɚVRL_#\pUpqGÁ)L]ͬ@t B$\>'*wp8 8% "s8K %^#Q6a!bS/qPpjq q:::>cCld VA#[DCQ@]hF[ 4sɖ_}f ✊B< kq_zd 3C=]]d-l`׋ }:GFvasPGoo Zۃ='x밂p8' qR ,VF¡#-=?չ?q/qύm9:#9=[UTV)ÍHS j= /F mъ$)Q $ن?}XA˵#~93۽MS)V) Jev]]^SVɉt{' 7eqZ}QT+ 5\6cmROى8 BBWW&Zinna)Q8UPA ۥJLS"ye'6K* (ܑyDa[90/~xt=/$bjAB YM1ymc&+>OFb>EGj;2peQiW5_GAC.@pV+\H@BUu?JM]g9zBh,V] $z * ǔ>09~bpǏ'ǃ! F.Lmb!OtAT,%M6hҍRdZXf.ZhapsH%*a-Mtdj2JW8\I&^.RNB1ZR!Ń둔 7R8RH`J$@@LI0RkVBv×*@XcS@푃qi&kM S7 P*ϢTuB” RIz/ģ>[9h ]+׻rU_:R@B_R](H%*xpn4 Q܀cP fA︻Xt1, TDދ a_kpAM aGA 'H@E'cW:*Dru)((yL&ĉENـts)Bl432^7梦){  u> c@3 J!B DN#Ͷu}珯vSԫr+d仳+/7'F/]0TQ! tlV \:~Jd{8w%;s{nfg<ӞP Eݺ꺽O{9, AKq@Q_{v##_|Uz&djέi>+㧯ݿ}ޝu@uwv ?Ņ ; Lɓ'WP%*L"\?kv0hό_w"X $F_YK!S+HJ(&Fk=\dIM:PۻǾ*ey\i!B?P)b"#(\2A)ǔۘ_򓔋l 7Z O9EudH̿Sw58k84P Eb*hh}ťGC*MZ_Kw5/% +ݗ5D)Pcqt Ԣ ~>@pZ;:vhCB݀LKdU>.w$HR'*S;5;k2 =+:/cƵ_+zP{$ZJ 묂:?$, -dRHW0q5!(鯍<^qrVkFJ>\xxѲtS&o'jcdt&gN@ Y H d)C@2<~a3il]|KOhnأ棵R2U0M_;rM L]RPj]7=9+E#+UVFϲݑa d3_ 3d dP:" yT΢gnLߟG  o<#IO"D`tV1n7?N MV Nqt˼Yۮ݇wZr~kZLw鵬^84*ƗbCR X)/5bU1|w#\Өy*kș3pX"F"!N0++駟|ɤ+X~ApًD>h͕щkZQz< )iT[[C h'IHQX tM Xvg2]z;[ǝ j1T0BЇ?oGG*,_ҏnRVnt"6=K40vKsξ4V0}3 U$^1<]Btj z hġJC«JT!̞?ߨʫsiH?X1wp?Ȍ?etp8B^)W#k~_ wW;(/8 칺-Sޡ󻉳B{O%pl[ e1>3\9{hBb% ,"ZqvkXgni.Bk+Q @>8MY(!BUX(mgk_WgnFmnv3B_Xhz_]i[RطJ^gߡjʀYg3'NzTD r;x]I{aPJzi5*pMWahzOϏM~߮(%P<*ߑQ|W+A]Ok*}zvUt*%Bޛ[jb? 2XZ>9~\.7xd'${FbTW#*e;OyEDa(6GҕS5HTڮ e/`vNw V%:L{I3On#CO|Vea{í`|:w?{D}ƣ}+2d*UnąۡCl~o"X{8?jvb# UAZu4.Jz?|+o}\w)ujԻ2 ͙LzM0<<- @„*cWyr' LV0q9モi= M%rd뒂)@ ho0kCTB$*RZVrWfn<ێ:b5ztrۥA{hD,GcOB=AT`g$1EziuG,(eJ{ӡ_X+(ba _|2.s+$uM% Deca X$$'$,E)*~(> R-C (%]0 a/Do+kwȄՏhRA1]bk㦈ATvP,IS^2}ǟBC p8C@/`Gz;cuYT;INq`mzB7MM}~s­0lb>/$~B ~JTOV5Ow5R\JTJamΆp#]$ O:ED@Ԕ^QĄ* Usjtbl;o;#ݝg^h\C[[}luMn5-BBبTVݠuYP:e;';w0}HT`-j_c^܀$2Db^8ۃBMruR=V5&Tv(5YK)`p(aKYE:NfS-ەAr(RvCfN jZR* S@uEY#|vl'[\\byA ^tzUN}^uIc|{9_3,/+=&P}wANA`Uo߾Vt6H !8|֢EEVoA e叚TRFF<-2IY6<<TC?^Ƭ]=#zZ5蟟2 Ͳk0ަtgk^sl^UnϹ[Mr`^}F_߾=y"j`hmπlNfW,I]gTN{[O_]]:j 'h3N&w KB3#ɡhocQq".7wW"yfV۞UVE*9``D/!ԎI eO c?rb_ƈ :{***@(X`q…DKOJ|@(:3V`L3Z!ZAbD_}ro ٥0"=" || NdQanAetߵCpIVxxRnGjvV˙JJwY}G;cڧz&eR0H3ى~/k_z:N 1UPU"WjDeق m"De_pܰX x;w &cZ-Ӻ3۳ 'ߧ87 8v<dŷ844 ۝Zb{=r9ĸk% tQȭ m[~J.tت:yrAT2Kq2# lT@TM}h Hxf?XmZ5h+ѥ5qxi"c#P❁wx&$+=p 0`1 )_gOTyN=oog82/ ߚtg"ܙ@p}bL6Fl3_"ѰޕJ]53Rv*Ϋ/=xPK+p FRHPX=`1 ?մ*}X8XNo.D@DnC 8!L^C;ȳ8KKUY r&V SO, |׌ u71@ }ߖKֲ<%*)Yg2 agmNMtw&]a,q 丵(}WB`heDƧj/jrXf"rRT]2m"]\SeXcC"pI'."-* \.$t F>nkzFF&RαoYې+.”j 5YEM'#OxĊC WAxUx#%GZASzQ/7_: ~Qź-l 긻si-mw; Ύ ݿ"&qdJ(-^Z%>X*^+>8tŰYxEF6\lƢ)>aVP+gUh\\o׍G2Ott~<4Ykį 0~e#{'kA!0S]] c:#`#Sms!;w70Q ЫC#7Z ^vX2ZUXU`X{5ط`{+E =?}ٶTROZ0eN qL@!EaDE:G$[hoIϾuNM-@qәP+/]k L[[)~筬hƒth+#LW*ǩTP_}`Oo4Z.,//tBEE:*V` --6 a(LVU8(@A,@DA2Q'0j01 1kxAAŷ@H|QBׁcVx-Z%% c*b7XJ `=B%BH'BB%J^%= Xǃa$'xu%/+R2ؒ?>I M/.TT|}6( D:iϩQ ovT;0to_ >PKJ$ok)UGIȡgn5u|*SsHWqhhږe"˞4蝂"Ybx-xW7 z <g#p|+U2T?KVnuaD98ūW~ߌ092s7.|Z 2U1S 5jɫrN̿ķ#Fon@@O@#4l;qq}S!C"a݅/SaHg|, 9DHK,L.H Ո|G}C-/S&++G]D:'3v?E&`,"E@܀`!T?P 8aY"Ь_8DEJT+ GSu^!%LaDsއ;y{%DO|Bp`Fe8b,AT۔΂ A~A [/b >|鲊m*LשThO*+i('oxk4l3VXUr 4`gJRUVTɵvDW9乨\D]n.DRR7t2],~{Ž)0&,Vb~CW =/lTiAv'b-3I[_ f꫶kM>Lӧ*;p#A^0h @js˫o_6T^%S[ʪհ6ĖF XkpXfƴ03ڄ?ૐ`_)h_7j:nHeC&[Ec!&C A>1x*`/p λf,U_0myu{rdrkP4|sNþev35/נ1+}mpkQ3YY}Ku7rakJ7|.y/KA!2qtxڃ54f{ˢ4}#w/AplG[ZI呋D}`~ WFﴜOTG_;84v?HK;[o@ݠ<ˡRedArJl Q͆ۀg K5_IJYBU+l{=pln.j ?d"!34yAcpl ᆖm+#*dA4(/AChmUsͪtp]CjJx96aXG-YpK^R_~XYy{/#O{rdҫO7n/o;~9d, gǾ 0­R]s5ejy#|GNԷ^XԩS:U-.`9@v[.(OK?VVm8llXy}mSW%LC @w&G KY 3PoG KZb<yVq&r+rʑ)zR=.$$5v/#/P׉ ߨ+'5XQ8 ɇJbY&4'ATuj-E8.xqb9N ,QDuwu^x>*DSYժT ڧ76=|! GZKUuykQj0GrF*Bhj?b`Ag j 8ol3GήZr$BbP)#˭ǻYn } -/k>y"?~ /Ш.PQ1@dBy"ƟXk]S;&T8ꛜ"W}U*meή@}W}1H?u ' * *b*!(FFz#BduI#󉊹xaƢtӱNJg(/0BQ4%L93a-*PНYp&ԑ`v^p9o$GƬ!/<;|}Aߤu,x1Q[9Q @R p GOیhrvuB"0anh۟ޮV-4C=c,fs eL飻!$2-f+#*X6xŜN'< $Ɉ @mmmxQ28 -Ͷ&F[y96VS늗@&UEnplA ؀6ƘTL,41Р҂̙ +!GBjzd>'4]bDja7!Rs6#çO_V%5Z1J|&*{D( oݏO y "_\yѧC[2l% ;נyI 2}O"/bdR{=bNTg=ժqjWbדUo .ik{-AT qP;۟v -yj,8\"aN)}bqX{t)@T[ohtfq1)QqVP3CDi5/owhoM&k;6])`]۠Ϋޮg?5 D=Cbs OxKeUs1#Ah-(Dm^f`G'G+HEcS/w5A0rZD%@|Q|^{ k$S_m)Zs %zHNWR}~n;@ e7IHh[96E3DѢ!.k\+ݔp-YMARt?`=9ِ a #okWo].:{6\AB}dpW vP A/GOm1[ґHq[߶9?85 ^jx,NTz:zȉvU|;ջ4E̐Ef,V`G~iz0a;!'ڊd-\EUUzh) ׹ &p6]62 -:@t!))s U0VoM^LqoӶ>k$kX.8( ZX yDң)(Ј@.zP~}*]Tk~2zCM@*~C!;EmU!N[ټC_eU+FqEE i?H灘QV|nAT5Qj66~rv;e4yJmmMƛaS"}\.g!< S aKt/>'JR,zi`pcm'%[',_ٌ[YӊY Vv$RU𳯣ʉs^!@h'g>PF p0=53!0dzmڮFUptj (( N]/W7*הZT?{ŕ9}9{9y9gfQD0q{m$2N88$u HP:'ϪQݨڍr.uUUk}/&t:?/׎x b`MǞIgwȱh4*s?=ΞoiU*KЪ&jP,57XD.>Q{{#{>ֽ5kza+5yLDQ5HKܙW^ؖ'p 7̣EFڵIgQӶ}^ϸ#(WPQlԉyq@]"htx ad.=XL'g>;<_HN'6I .1SF1<-`Iiyeӭn}iך4W7j+]vc14Ɛ *@@+23_|1KR. 4YD] lBV%L!ĸ%hXL rH_!3,+fc0v$5;X`SU~) c P|#En!RΉ4B  MPPi 2$F6o>'m߾|" |ŕO~}s=wn{{?t >2sjfO (ڮ3'Ovrr3@EZg{nﳯͤ"dM_B[c&H##7lķc;V DOg1 (_Fbv#,gF5~.jX{$Å@gc,bF.b+ N$fZ}Yk#p+b^K|(3:k8!Y&NJLT@($##!LOo㯢N*DdҸGLaQPdvl r4`׼_FʧH2kN&EFa (,iXsUUc8=d9$;8+U"jG>ZVG-TBA0l&`֘N%= C\B2 (ef@`G(a*31yb?iM:G̕V"D ~/*5鵤SYk K3[^~==: ׉('fBbMp.%U_0I`:Ly.J3R`t\yБWA[~OxjrQo եzߊp5sڦ| / PKFVSt ?!ūt$MV&hmX,)ˬsՋb}A1 1㭹7dPuLE_~QěJ _M$V}+Mӛkyf1Tt5kyݾrN"4*F1z{Sk~ЂfC3Es/o+h4Olci+)HTD~Z09rK)968y4)Z=_~)(/;W=xi`1zфO)XB(VGddGT1i_7q!y]-!!y]++1ԩSK-JA7TG0x-CKX&݊ĸoj?&*M>%jK ԄV,P'o}Q*Q;H0G%9ß@ ˫%f3@.*УZ`;faC\v K O%u4U0!nݦr<_̉0_ ]Ib\gUFЄ1"QΙMjNCReЦqw@fg E /`,QbeM y@5 @EY4΄0?}n۵ntǮX,=YC3 N<2߭'9=A2€5*ǟ} L\$A[#_tz@coZP..K'λ~#PU鍖֢j- nlnWQbjm47q䲘R]KTf#a\ % _ficmAF8fJjG6lXкwCi*P11`?:tw& ?CR*7pj-0WUuo22-|5/@]ZIulpX)-/bișp[N {jY*TiKis3}& lsŸsr>14;=Suriͺ> m(oҘ;dSlbg!zl^ѧ:HX/p $F&U'W6G2T}w.QNi`2؏c^{2s2s1Hw$PbE ^S_CCRWRJ8@T]>)ۢRl tтW5ͽAZ<ܺjk8UpO[֪=B;5_mc-v8:G(U]6AcMbɱѪݷy%xAVKkoR? O_.G׮t 8M1VJ[P<DY 子)"& ɞng@.걒G-S2[S#c̪ bFv )ֿP#B>;='1}/@M \sS8e JQDs1?"NPk;kñ1H%@O^vB$:ó2):?#V,Eewy{eE d\'ӗ@&h&vjϼO]AGvrWDm, 33SǪֶ,R]݂F9͡>j-PI~}lAlH`oљ=F.~x'G0dUh;\* m+g=ڀTW2U@dv}0=F&T8 4U#S/," o!I Ьnz#܌:Lp;;4ŭ7An'%T:W_– SP-o$ lP5R'^xڢ#ţN&yq^kwW9y~m3rYR~oу$b%;n'$mh9~>W3~gX͒S&p*c'mOrMT?3bhy ؇E1Ӻ>*whaAڑh/aN)\>D`. `$y5t^%ID0'U"Ј&0굾.nj6dI(7JM$Sq9`6tgkLSxVKZ^j !Kme1!/wIῖd6] xsƠ֠7z[hh4=f*.Gy"hi,[4-~A".ۘڜ7b)e]x՚\JcVWSj: KAyU Pil@`AlH&"so>'ܾ]޺u ;XyNxr}oQ.q1\Nt6@RJJW~D&OؗXE\Q1ε=j႑LAheȇ-x\_z[W6ٛ -&)-=ʩ+I2U6,]lGH*rvEeD_gW`bKLPtֺ!nvzB>W b׌̖\nK2.sY' AY&Uf@iPko֖\$N3n*1T)5GȜ*|*-A߼y9H dEݵ{IޟӝKʹaokn*;$gh/? ao^I)H#УjU=DuWr2sc,!R />SyHci4Wc꾴sj_"<6j  m B)ZjzDc @kN˦3>3AY]I: 9w/rPЊ*8F=[_-.oǨ'%Ge++,͑SmU*!E4TfY &NDUgZ? `%&(^c# PK%Z61 4/%;IJL@lXyyӮ Iik,!xГ.o=˜(z-/N%\EJMAmm@ }ًo#NۻbGnA?hTsA8p*6Ṛ頳TGh(nscLӳ*qcRnxX&No d9=}=ъBm0'GAXgvhĒQ+J RP(ʟw~i4*Vo?N㢴 :F#,nOqġOÙZD*LgUǹ>O_ݺ1Wiqrν^yb :СNJA@e?!!{IBM[;L=bbJf],?GTosv<#gmy$ގb @!P cbcD 3~-{n۾dSwX'r.% UPp/3y/m%$[C`5ZLՉ3}տhd$&bnPI%;Z$b izA(y%\YѤCǎh17 8*Q+%*d(D6nJPk&W00]2.a<*sO :uLt6܆ @LF=*v㨫i{&8;OFI(a2 .aI-Lě[w7 ]랁_JzXS?2ken߀UD7B BPJ^x27@"4d i 83+ye޲?nFrAr[wm'D `K'ӉX)ٟO@&tw|\#F0֥R' ~P[uo&"1Xm /(lhL[ 幒*$xgS&p ۖfM`#tR2yuv|&J^$Ps"\jx|*ԬU*)nʳ)vy*2UGţ N bǡu7^ AE"Frџ~oUk_:Œ{&n:L NiQ׬/Lf}ᚇ8kI]sA)W\#s['ɐ_8OJPe;<_ԦtVެ r}כ΋/(s)U*l"9NmyW.Xn۶{vCdcP^r{=I|TAْ8M!bȍ394k=db8U 9%Jl,EuM_|!N: KƝ([djjʫ8!0WP6s[جYpSKˎ9}M EGʑ`9=%nt51˹ ,R6ňS]S"dukTeF6RDJOE<_Jĝh~ O'Ш K0-Wϼx~[ޮ= h &c`e3mSEk혱r \ek%`hb_ r&eR+OS;ko߿nRrWP*/s6y|"kTM?4)TfT{ێ,-P̮lH}e1= 4JLVOs2KH ?Vnp_TR(D]p< qYƅZڈloMN%bkt9r+jmw~i ӓxim^$0o'FY33GWi^T,:ysE""\ sU*gtnUZ“&E4vI@4(jV*5{:N~d101]{u].Uu200$eJulQUrʄSe"v=H TPRO8 O'#FTF8 <{ ?4FhUz@mS+%8`.*} AgiyCps:Qhh58uzAu@5b=r}!FlXPSEABʊR/9rќi}p"0Rʿ)U{FƮVl+!cU#^"e{%䐎z83Z]Jޮ)<\&<%m1%:{g4W 8Q"(ӠnEC%њFΕ1%_I5x, ,h1K+F\ȫC[UөP_|33< -P9T>BH0LxsHɚX i*K lǾ3Xk~L~04XkY]:Չ fskc)Œ5%E԰HVcDIᵃ0Z@]&(̤-}}I[R(j2/p4x"t{C \ji'T}೏cY:ޙ&SE69%>XSčǣdNgDBb+Ԛ)z&c>Z(,b`>5#n]t:!,:vd95)/(-J^4Y,# ]7dG(r 8'y1ƫG?'h B? #3=cՆ^$CZf]yr7qnjA.W^HqOH__~)@=9TdJ$D9cd>}+rM?uVa z9(0P=3DϠ:bӾ/'SrNxt :Ѣ Qyqtfg嚑KEXᅠ0xĜ~4SX<= G4Gk ʏiGkpᨈ+Q}GɩVV~o&"$~gBNGsb:ۺ5Mt6lX-$9-{) qpN9*0A^mrh&q9suU[}̲j`CYl@ C'Ome IK AEbX+ջuIrCQ/jAz69ƁI{JK@NGGJg/hñ(seUdw?_ P<% %F^rW _qk V9Ln"N:r ­XׇNlKEtvj >ɰ ıF7x^'4U3_Q%;FAJڤ6v(<:DzP1YJXT`NS^D)g`Okl5TrP‹ST -|L4VW TtL{ ,j@E(Hu'N ]qDϧyg:+ P6 Llf&e*˿@6sm0K~w`0w\N}7xYA)믿p8+8ТEרpPx<|ͅ LɁ;}*D+綝s@,ֻOv >q1P=;,XE LqI"UpE9v5 ʳZi߿iױ3z?s3(ƪ!Kltl mT WkUä_P(Mϻ"Q.gqf+iӝ>9y*-0-L0q"%fs* FksIEkc %uI*R,|SSa+}Sf:[|`׾L:9404XI\ԛ4b T7; sRjx*6h."|1zF:lsiJzWhz쉈Ǜe3hg;[zÑB?sa^Q@E'󺢣"T|J k8`@sSC.αtW?Ԯ`9'tvbO'gPEV=5BՄ:ߠA#+ T,W'NY hQ՛[7Q[ZZ0R|T-l7of̟100Ɠ/v@ T3B $c~*rޟ>UܡCD:ݟˎ5>iKH+%t%St2¤Њa*=ICf:I [Hȭwџ c0'7t{D0Z:3=;Q]J[OA]8&I mxܫ3uJ)y&ߏoݷvnٿqzս.)k@E!~q&71=GU]91b;߄aKc%} =ez}WߧQZoYlYÒV_z{k=\6Zi)Pp70l<Jz+I)VSێ( bgnTV-w4xj@Z:F2s \ٙL]{ @.PGu={veG'ٍŢ"dy+(j*XhDiN\Bon&MBRt/X? v%J 5 oғ 7 akl8 ~+̚PqXdC<7LoÂEBEacㄶ]jU 4Wb( %P18>27G_w;K*CCBckM=~B"[@?{4V doi,lkkwsGn^uȲ:J}IĦ) iAZcl K.u/EHշOШRIUkH (Ŏ[Kd7/ B˴}J!P7?S & +W7ȈDB%Jt_}8[pVV#g/֨ȸT$<|⎩0LY]v;UA#y TY<`#1g.Qo=XVB =&#Q06_IQVZVv,ZQvraEv9bW rA%r|M5M$`P/%rXuAflw-gWo{ԑXmNdc.U/sJ8^zBΥFHWYwӞ mQ;hRcˬ  @G9"."gFTqr# Q[uo&ПƜ#A/8Ħsx5ByB'P`wKhZwUQ_/`ha\wLLK^S9SU+9kiZUtY] z=%Ii 0LB1$z{=km-(J剆)14̭LECь_ԔBl;_&HnTf?aJ.7 !hUlS}M \&Ib 43msZ@m2p HmH\+ @] K?.\b1!yV"`O[I1{⬅d,RXI {N_uϜ*(e":{R|lO螇4!iFgEڤOOɣ$u8LMN+p4 X KI"`p7KCv2/rCU}M(Y׹ 3T, | (ߊ^(͂Z3](г@B*˕*! BE{-g>u nVUjQs.6p1i¶2/+Eo86Dͷ鱹qЕB+?T414زq8YQۀZ*1Wv2L"JO#ʸmR "h#8,ңcԞrbjmeOcSr$YgMX oè".QXj󗙏ZT]|35d{&st".4\tɄS]sj[ź%:ڢY5lƶ&EHr:,RhPaEPIvmմ kK5j,,GN⢕JYL2 qr|"䫮ؚxk_DJp\Un\q?R8ޓbN*$ zEƟS'0}=WHK"ÉHFv<񲻔d%cl"~mk BQ6,rd\"Rlo~BcMKVQr؊AO\z݇UċG_UxYER>+0{inj ~RFD"fa}3G)/m@2\iU|w8953.F%B2Wo= "q;q/4ՠ,;>f_{[ >Ϸ/Ⱦ.7y p9RaJ}_\&3a=_RH˕c{HMEF):ekOATiFqGq4U/ÂIp #Tn%_T:{N _rq❱ BÓR5T Kig{,b6?Hdogbk4Y{ކ;(o)p(Z|im>7GHZeEL-%|xPKUEQT+o+ɹ3p+K{fNY/4t~9ߥ"+)$XD+,p1n su̿y|Z&}J*UaNmfM,_N7N"}  ;J&@ae"$cmZk/݄k={,Mu3PFί>x@(\[卸ķ\٢% #G(C~*Xnx,fJb-6={> ciK}#h*pk( 9e,|7„Zlhťo,i06SR큧?q%ݏJܠeczq+>-[YaYq;Cvz:*ceVȗ_U7PgoU]zSg_P)>39d:H]$5zIP(*?vJ9F>,hO`EGʢ'8PŽd4XFA޷ reW g.z٫l{3}}1"|^YgYrҶ+g[M_챖pAlZ ri TQ:Mʮ]R:SV_ڏFEʛ+@p<'Z!dIetJ'gƾg;B+jB+REzjjՖ{Gݾ'|c"1J|z㩄Zp!uVPP0 A@ѳ_|%\L4*pA_Y*7ݻC3gF\,.oM}?DpHtOL(L?[DTx5럜[DriYx'Le!PT*`qTݍē/>ML"$tQyT4P oz ծ2BW`]YLKMK[3sb CO3# q hfǿ"Hvyl'^z=(3|sB=INS֕h\R8WhrĈXSRXuoWh{NV3&~nd GhtC1yb(˿$@ENʛo&:W'ݹekkN&?nhŶ&ȝŊ| i(L?}]}EB>ci^yMDb !" 49`fH~yWUkșEΗ(Os6$aqW`6a|#BQ)4N<#ֈxf&B'v =HlW$ݛZ?8~|.Ŕ2kC&Q քƎ8#1Vl5ȝCթ'!#gjc y=7a5"\PGnd%I}{B<~u [7h)8pEwjlȌ.ˬo 8fT__fu# )p27W6*:xtݎ';=Aƒ ͡bKi'zxA ԙ efG4-\×{I@Z7[|dB2 r+LvYJX_?Z_w}8d&|9!rj|t缭G>@JGerS~;TG:?ZhpNۺ=TG={WU-V8;;GtS֝~Η \/uB23;9N߽wϮW^~{s}ϮFaMH䐜+XAbE@D< E" @ ;fgFk֞@mUX[>_ ^ji ӛ^~jԎEMӧQ+sgZUhA^ƹ=1{7>-7 kZdO>TбT01J'wF!ݮ,*^IblvМD*8"¯ǵWD&BD_@r`A H E; . #Fb a_~ւs} `K$!{nf%āxՏ9T|G&^9O\rY.Ց'J|2vej."靝}Ǯ[jQW*w޲:iTc vDP93S/E'.-K`Y J%?汫Z V Ҳ&};y*wZ8qw%v!T%pu +=*(|xH"\k^O^QK_v8IXr5@lyXr/SLf 6~n~k큗5`<:^t8/"kT uT8ye ,K`^npҘleTpCW&9 7'pЕٽ*ww>zSmϼZe& ] 9 IT4*M?(U-U'OC#͙N2P(֭ޭHvv@($zHrÉkB<@g ZKY"?:ν߲]Ju;oC Mr$P s&hpHY'%aɭ7yß.R2KU$isӂjd Ғ粛(k||=K@"MF XďHkƼZPNENs7&S Oy < 2GTmH \T͉(-z3("Agxy52Y>s5$ ⣥U*$52#ۤ,.}c!`(}H]~.T,*˱.k ڲ!!i~\@~N0) #ϴi+=XvHּ@u?['^}Bjə適ԴHsžv[yVٞ t?JOTRgԀ`_O,gW|B9"u({._%RE\ duuP mnki[pKD/vY!!̧$xdѾ_jm"͒*}ctt6}y7<Z^xe+ue;?l]`#L̜,hB7\>0sӁ5e*!A0RDʟɮ-O_peρq.VdR8Mia~n8{f] w/4Epi$ofB8=e;ks}p:E¸{xՐҴR%_ݣ͕.*J& 6F++ 8 +BeU 8I|mرcKZˡPYVK¸I!碘i8;T$pv cjq;|MiIٵW  t^kz~=QA{Ý7{=54`x/gMU?Derc%!/uV37fL^FűS\ QRZ$XҶwK5| TI1a_X n:"JW*liغxkʖ-[;Jvt[a#5%6*K$}^e|De {H2KMP+MZlQĞ}4>HPY1*XOiv3 LmWg]Y[oa$=ujIFHba_wCӪP?>_T|QyrWdj{BwvnTR Mc哄Q:_`Wyi zW9,Pcb@e5&mݓN8*r@z1T z^sVo3p,i)P`fF#Y9R ; oazT) *T"5hT flٯϗno*lIyRT((*kXvvKW=}0ME Q"~6yTj 318ӝ+6) +US Kђe{ʰ!!rE[f-Sz E)Hq߽P"0 ӲQYyU*Ik:Vsmz,"x<@f>#Ao0PѢ/~._ʎB¤tk "oVbKɋ w W-/5Tp+F-/n$ `hZ>՘`sqrJC[ & =&}KM/i;ɓxW ~f{V,U]Sg2PP*dqrh~X{839[&S`8 iNnkHo!P#^$ c~llln_q o7WT+.i\QR~q ;m %[wh{~; A4,([N J/UϰΟo߼RQ}u E@) ,5 M>:s.5q(95"䱵3wJMZu`u P TnT|i9ʫuGC|"p"2"FMzV56-{[gfT6!'YG ,!"6@an? TVch3 ! ?HpIT wE$KSo"dw}W TP޹s'W?%EP٬ yGɩgqܘ *@52PBzT $VtQ5x@fPqT†-+j!Me:)(XK1־^Dn+.?BP(v#J>U/L ['O }XKj^bzC$CNEܽy#=|g8 u=.8aKB,Vbv E6"'KLG;4iwƂ`*v01owKwKYDݣUɆVZNRO{&u^&y4R#)u.Gwcj Z=ܨ=*=K>@OP%`4:*Ym"1"U' `sѶ)xx{SqĞ$tĥ4G~آ$}*Uɩf\ [<&snV==11 J`QU*0Տ8F $D V /@JL#MPr5`NPpE'P'!x{®G@Fh0`ӓĄR`C(pV%j??_%g\NG+(5UDp3DyDuP= XRI'_rWPRV(=ji#@]VR h4>ć *yo#%2N["MT3 ?>Rx4Peex18.j\iA%t g'~B! S*M7](wJhIL? ,!1Ȇ*0Gk`4qyOȘ,5J֜լTzdEJKj'oi7*  %L^ Y8U[(9w6 zC6Wxa6m`mzMEbgO\nkn09)6v^rpu3`;P"ӵaFOqok=BK6իD<:ތMc~ n+5 ,QJ sFRP:+|~ E }m3%a H,vzr#rB(`SBx Υ)CX7QoADJ y!u Á=}iiru}qgyc<>uA3 5z((@Րhe*k &±8y!}B&dxOɳH.G+@a*^q5;*Y{sVNo J!,u(T .* cJI*(PV9vMƽ^c-&F9v!ɇJV.l#I@Ei\Zx 6N06M/,I/m #Ǭ8#l`ٛpڂScS!`Jl"p={;807Z .[&[}\k:8644 H%^X:$< Ϟ+q.SO։5lY zy~shyi!h0H `|\l)PnMY??J{>&˱x mb"_Bs4{ndguϘݹnCUMb(0ug΃sC_9+$?*,j=twmhVhf)ďXѮWdqJpb&/B |I(eV:::h?9rzcZr7 zLT!@x=vP i8]H~դF4L lN0 Ċ6Pɯv?0kn@K{LmȰ_m|>eљk.frrƚkMih 1^t=K:;0LAJ#w\Zo' C+tG`ھyf(؁L_y.^J^r9k>L&IE1QXm>4ϓ2Zd~#ӊWjs0}~& i7 6NjV>$ø,Lg;A\APb_[v`_(gl!er@):1?m\| ;ϕʎ)&pRB)}WGt_ *jt P!6#&M"Bca@F$ĻvV q6uYbհ@YShzaAZ kfuf13FHF,R D2^O\UVk'g{u[,ҒqÓefg}_\+-= Lw:d/dq*.av,L& EyIq`Ldw|uc+FI*YwlΡh*x= }j՜mGh+Yh )a"w )L0|YA,!QCQ <cuMJΜz#H뮟6m,m+JU3sM_G!(dXI QQqϜ9ij !!'+ð1V݅}OHsk| dPT0X6@H8ޫuUTq|V:dj&=GGnA̎U<<:Cy_/ wxApSёꂑƱwugٸ]Mt$ 4mB CoF p82iO10ZB}..^.D0bieʲ&ļ` `(ʹpOyƒݥ"% /E+;rܝ/3],R\D )OXG K0n*>QLWXD*/ח `[ڑCXq-IBFT7`ߒx95#ɗHfM_,Ŏl`*geީHA濞dTqpX'nnı)t:ߞ")kTh HIb?wFWY nj Eb1wuȁɡ#ړ Cǩy2uVg61;jU4A"aH"ZMVK4PќHҮͅM[RQbS[^7ԙk$£F@ po.*כ$QAJZ>沪 oʭ S ׍& pj+ P `Pxx[ɧ:$\s*PC{,ȵG{qBps{5O QdV939gN~-F\f%EN:ޒtRި\6(`SDL(\ 'ȍKTȮ6V„]_]K,Wj3)՛k"<΍ݢZ"T4VY&ō3nbMg67I1"¬#?*0{ScM?a]unVS@R,<_1}fiӍ=y&;~`*6*i@㣎&WFlKHBUUgpoD!Tn BIT ~ J#jqgj ʵSx㇜u@% MAu16Crg]&^JDeݓٞ]VwG%_{Dot`lM595Df1)k#Q>XGzzX G-^~+*f[lټ>?ItgsV=[M%wyjfi1\^i툊.4P\LKvlZJGYE/~ M_n xd\Y|gJGUx`%~P:4Q>ƚ) b6C$&H@%}򓑾dAc#Rp嗔Z^ RUv׎D'`WD5+c ٌ;ET,QGH5Q#\ km,e|?=/U}aײ!OlŮcQ6·~ƺY;03yS4aAHU{;9vQ5 `0p553 ,lc:wgO5ɟ=ba2t%Fs׳F8QP2O"< p48D7jj&^ͨr7\%Oe5e߾n:϶me5{^2L'{ Rdw*<7++5q9.3f \]xyOϏ}C<%Ng> HjBE3 ;"):iƬA(Kxa=tcv] `{P1 "Bb8SswQ>[ކ3̅@H8=B ->n+c, żu/_UsbΞiZl3vH@%:5i5.c"ѫ}d{RcgKJZ:7 E[%cJ7(} +>O*(ΥK$bSp l}.zNt-c#hFkxh}ׯ"^J2P>h;ZԪjkT@Hϱ1eԞ%rΫt@V/E)×U"H"ߡfr88^PZ0D_[ܞh$@DXV(U/[owfm: TOX?r2 ?(`U=hXцzg瞱,:#(ZKq/=<0x Yȋc?>dC*2clodP=OyY2@ 2L -zFONc+#&P|᷍#akWI@eϪMf*'9E/JՂAt ުS <+SGST L FC _q߃Rw&+5,ޕiߛ[P\9L2TVpaS_EC;P]s.J 0/: ,ܻQTH>.1T<>[;/ձrD,Z>)[i5.ӹ+;}lᲀJag:jBI]㾧{( c@KZ$VQ:)'&&q0 'DxfְMOM \}j1->OCjUTrRޑlNs{(;YF.=gQRtR 6ɷu3·/A[ q")IyqĦP,QY 1fz@:jc#`44Od uu`dL9q&e=X'8GiH̬q roeU+D5!hwn>EZ5 !X"Nv, B(w`#$hĆ/D1 %Nq^!LƋfѐƇ8 CD /،?S > L:j( ޹@Х,"QFozMP$xzX.Q~MˆF\l  pGbhPXř,*f˹o`I .Z{'5ufFxF2B)DFQ)bñWj{']Ya {f={~ Ix@".1B=s1Z~hld m]jhe~we9՚2 TSey'NP*e EZR*v|UZΦw>Ń~| I7(P{"b'?QJQ@: A:О|3hmOmR$phM՗f8w *@/c$E!xd6Pe=zAeKܱ/lC~|O TYRƨtwa랣@KІ1]l}W~WPNHU;2ƭ1^G™{@~98$9B',K *س}=HLh2LEP@c iә ~ F9}滂F$FCxv)y3ّXH//@s>E#ޞGHhE]JJ\ZFcOπ70 2ş =k 3$()z2@ݖS$ [E.;2r3aԸ]J,8l$g`55ո˛vn,o*\RB2l,qg~@~GRAfu=vrՅ ~?K{Z&f3YRoऔt*G* Jԭ1 |'հԏ K@Ek.Ttbs"&y(w<{-B~K͖~qR ~PP62 t6?X^C2Dg:,Ż`GS)[[? @tB'wxXK&TM$D"Xk@%@kl)aOE3Uې GZ-ndIVArI,TF8X60l&(p,ؓf7tjИM >لDX\]U'D|2z0{c)B5ECo:Zfk]Y7^Gڟh)J n?勥Өo~:m!}}( hvV?<%*sFX3j2Y|5ގFGG$QMd>)IЀJ Z ?f4mqEgUo8\K߲~0a'v]WxrGW B  ;̓Gu6ZrnV§ $u{@{rtDXIv7Trʁ Z ;5]P PϢ$b`D&Xۻ/!qhD7Ü%ӣG\F[p頤'K"sj@V4L! S E?\gMD f*b>_w0XQQR)2~Pg.B릝Ԇ'xҭME{G?[IHK{=(U?'رI6;RQ' &kg mo? *^ ?+&  x"27ɅܽJ,2CDG)*۱Q';ܥ ˍ|7=Hm,\" ,0M`ņ֯{jS-QY>a<݊~B!ǘ0p#9F"$PeA bq5#Ѕ"W2::O<(뻈ߙd Bpr׊N *TFx9H̓,5OJ-XHʵT 1u98Yvs"Z`C18`:p$iԉiBo\l{êZtjPJ׻f{E?XȈz뭤@Z.'bf=g^. ܌:.IGB7!w OI-.“I/C*pz3giqm]d@ Ñ#:J؇n4BW2TgH3sl{=Tite9J~׾Ze3$.ndqvRM:;*L/++*.߾<rRAGy tXp&Y+L.- {lWj@e%HRr4 [o32 ކ \'W%ll=-R+#"1bȨM@E9 3w!r3iKRlTvlg'$KqW @у+I;@/%[ GY$ȫyT\t-6'#Zf(E'PV+7`"oU!hsrEM7$K]ZY`ݟ_#1{2 ͒È/P2.i:`ӓaʸ70,Q+`2z5ρ`𼽭C94uYDp\Vh_ +*ȟwx4Hd|ӳ je~{0n#ًFxLyT~^W#ɏe;O%Jso`dˇ/<@:v$P4Pў5 89Q"ui)UmFa?}}(o6=rVJVpbWh!󣙬`mH%+ uF*@7o$VAa~nA{z*`/=6:Jf7%р{42 ;P*j[P0qr1t^GAچÝ& 6)ƝmUhq?Um`ͷ) @Y-SgIg^ry\~w@%OѰ7}JՕ0BX[_&U.UDb,h-hѣ,1O oYt`4(Еz3eH́Ʋ/wՒ@^IҞTځ073I>gAfoV-4PIk lK"1g]M%)&P M;7nkT]N7Qȑ# Pve] R #S(N ul~a|2 @51dppd/` +\X__^y X'MOT&a5vYĶ'$@}.95<1I"?20VZق<:V{P! "uV1!&S'sJik@ŏhM"ETg'-ܦ(.E^[Iݓ@a~2#IN%{SL;>EPD鿥^A \O&{s+FV)Q,h? M_0[;OH-rcQy Lp7Xx|/QsZ(Xce! .-"8bNQ"J?qN%I#c/D㣷 K ^([pGh7 s6 ~Y=FEm7T Yڱd̈́ '둼I\JB9J!U-DS|EUFhwƚm-k@%BĜϨv|SR)MfgYt/?KA3tVVWyTv^BQRTpPPcĦNO_4J!~AԫVbaX]r( S?4:Ҷ㍮:+h.ߥNT+ {i.X=2= oqP l*_x|AQ"!裏N`s_B] LoCTAR`φ3=7nPD\@ w_y\EF@ls!H* Q: [&=jawkE9⋪Ps*zyU2memFQ0 W3#Ue)}1,j^h$/02Ud>t,cBR1e2ZZ.2QV`M{:UJILJ@EgzԀVˑA0L"CdΡ^ћq(4µ#.5<~0"0CݷScܔ*k,ApD[q<Kulq45m oi*ZM%{ԇJe `I7- F>Sh> NMM;@"$ITߏ<.eP@ppo@oWʀD%rw7#9܋dJ?*sAץFXFyYv`vS%5L3_`(t2篍m+$wՊS6nC(Set,!XƽIikÿ9iLÉقI>J*|(kb?љ['N 8CPi|eqpT5P9=0⤅CW!Q1r4%*jGLL)VFwmȳi$̣R /2hhl dU 4 x lk,5zF3uJJGe D9mF_GmoV ں9XAa9JȀZenSAA@ \I!L?VX-H16$t P1,w :aEΡg:V†V%!H_:UfFX蜖C"tKDNx. ݠQ1l3 *DO4D k‘=ws8+lᫎ"f3U'Rr?4LT68GQ_(RQZ\HKKTR">3ر=pU.q~cJ6*I`ŋE[OuxJv)@C"&ڑ,( _Ow@ִekg7m;ƚss/E M*OF S((rh?f@e=X^޷?Sd׉|6o[j`m&^\FToL6+]驉;fa˽6@e(4Wټs"r#/ ];U O.w ؐ9BU-MRYbmPmSj9*ayWMR|((9gIKLlL4bBd!1 y~͙L ޲JS*g&og;! 1rCBD CEBI:nT~봁iOP=3 YG)z :<1r5<_kIN|L<"boT3 lζe-EM}m&(ji7ȭvx ynչ֢mgt+)o),o/R}cEOUe`~~:&>|x-*#\r+27Q/`z틯6k#B}VyNGw > ^d)Poԛ_[ر,X\SS7n.r]SRlTr>ML#e/p =Hۂꓦ$\,oڐ'>>5"!r~j&dƑc9}^(J PA5\dh" t~l/2t섭#l}7k(}taQɦ%76<_RTҹqkη.$N-={B7rx\IjX~MH}9|g{jMR7%1p2~+b3YYql& 멖)(7LLEx8 .:ȴ^: >qE¿9՞ˊI)"y ?e2?;OC-W\^)Pg0 G}!Й͕ ꁒ٬u:6@0aKd^N[7W1z'W-QNP4`[j2=H)!Wwd23N~?KFv}tA*K z /}aUZ7Vѹyk$緔 qrLЫR?oD  NNT%3g6z(x{&F_2@ol4+WJTPOA6&mP%"Tj^ HO; Cf 2 8\)vV2 , m./5۩5UVpl"㉓#cY~bϾᔌ ;IQ1:O@HO & kwg:'yj>m`lj"a>:Gc:`ApK[9zoI ` ? @o,R<ў"ؚ#ĮP^@47RWa!d#+W[Lͤp7u=cp&8W?'Ut\r"MRaI=?4tyWv-.P*$-M0^P4&&I;D$J,8QH@5C^ZM@mOMYd`6ste'6 `#iPy_xȋՂQtd1y%4PQMR,J$aRd᭬|gvTB=ꮫ1Gg_<;^m.F>Ro..?WXڵ兆ʺa9$Ρc/:^z=9!QAOKnI ]pCdP!<|4ld0 󉻯HQ`F|QؙwLNw0l6XFs 2V9;7+F4`hJqtp<Mg-`Yki&A &ן#KV Wz/Z3`Ubsekay&:AQZhgj-\x>48Ep."h#2? <5,v("PDSI8vQ4yPuRǔ( |jο-)P.q=f6WvtnSV%*-Y4-P)u9UEy!7y1!33@j% T4|l AOnlbc/+HmoEFEwwU; xS>?-'7 F?;[bK%m2-mfTbǎD]-P x'*E{(war kߢc'9(wfLNh Q#ܷD̓Vv{lv~@}'L ^&\S<XkŚ'dV鐫yW{ $Fs8wSL0ବ\?huX:Ff}oͥԳ`緃῞=x/|K§hst{6F Zm'ElYr::jNv1DT̚tYoY$ zFLΜ#ZqMIW cxEf4)kp/]”-2|,_KuSH XR{kKP \HhȔ7ת 'B ̰FzgzaI+!OUSv q ǎ oq U1tN"~H"s;m^eRjQ$*gZ6mzC}xN'\VO>m!&]xj)'2-i*h.PRXRڵGBIEof d2{mڠghJu-r/]r>+xW/e5dr|^Smd\y樼30vΡ05 ܈}AEi\|;Na f‘׺7sjzsCo䫫m^'jUv%V U&4|GsGhGZ9BdK;">T l"ӥX=Zϳ8MP].W;82@$<3IhP 2^jl)y/2|=J1b!U\i Pm \ MLcqe[k梅srK=m~2<9 $& 8Xp^=&#[Hƅw@Es<υp_ BlEevl=쏶vhI ܲA H(Idy!b?ҰiG˖ S Tohݼs[wMo.+A<Ј0U`"XO!VFoC=rPG\Z=túMΥ_Plsy5yfbP,ܓ;OVmn˩6]^[qsف SSoO~=#5QNdm <6 dPB[Dt8gŧm=;i9b|)>>p{\\g]ݯ߻a'9qZ'83D˟Ξcё VxA\69C q2eSZ- t+[,c{'ߜ:10SeVNdw@)x!"^ZĤl/ɬXۣcuZ H/nٿba{޳kff`vnprf{S|Qxifm`85lB┶eHTZ745mox%:|Ç"{k;G5:J2Ƿ-HҭTڟY抑}7'N$AB@) TPی6E{ G ̼Tr5ݽ0BkU:F ꫪ f!5КJUSU:kՖ) :(t> 36gv]*ݶ;o'"!𒯙w}')r&+(`AhI.,%/ޡzK*C]39> &oT7o,"Z W ʵ-OܜuՀD3H$T%fW`j:6X;7[<8Vp0 $QF< ~XęBai!HnDH \7Ӌ,Ѐi0J~VWّ[0!3<89r8"T>Z/ªKiKTL-FH"m)*‹Nco˭6:\jM99aƎs.Sm}hxe@%)MU[m΋dL*rOpc:z@`m'ޞmF޹?eFN,„8F%3|eDB)TYS$HhNUcSE [cbWT@ z鮓{p|;uk)"䷔VDNTʹK>xoB;5r@'Ko}X>D%Q6VHF&ܽV;ϣu읙)c*}=ׂeIKkT?$Gr4TtXON%;/)gc!%3ZUx|@s~'ɱ@Ahv:)H _Ļ7vG]gw<`a[t , 9DP(¹3UkO9%k ,0@/ИwU\o~޶+;"Խ@! Ip: -$HH8R !PNɜ={g^\+]ی $_Յ:QaʀTJ TF}}W[F#@FXr ?Eq*D2q)D}_ MD5%λ =PQG|v=霹5ߏˍEN_jޗ>gQA26n X%D c+0|YB"3|>X/tȔUFN{YqNӘqZ.p})1C T2\9GZ3LPS$80'p%YS:.ԱH@U=DE&XV[[*}—~|uן?ȉ̾*k K}wnxY% zխ?FN:>}R?P]ZR4#"r`ru9~ m5ww/).W7./Q"^Чj Q7NIhFV()I6@hׁU>lEل鲘<ZVƩj(¨‘k /,Zk>p?P |Y}G[Zm(Bv$`F#pI!~{Tu_@ܙYU<2ʚS=iƅݿI&P‘,R,O]mNWs*#BuP$+%N#]Uzg͚ؤ>OEEE GUZ"]9~f1c@3*O\qHh؋ ?F8[ѩsv I.IЯ҃O>d0GWv}f#,@9 [k7G]f>gm(WE^f m=Q1g'nP!GO{ׅvRmث /(]٧n`rhbVornTO+A6]IHjKapHY.3V* Mw]|μn*=δ?`%< ?2t0v\pe喬`FrFYJOJdPD ,)US/0 [fZRQ 's!>ltл(U??Ȼ<=p%N욱yks]iRլH\Qn%z䄆Pk\N5{| {?gHxRg;to#/?& wý$9qdYM/5?8BFA]m]::^mOҊU Zr^T0\y2o+3Gү@ irCl~޿{c{].7͟ӯP`xdnL]]W?ĕQLHApwy_Y9mzvUk,9g7B%k\2>2`E`ƕy'~dĩ1 {N5=ʙzGdE,wfc>H֎ Uw9괴^>탇J^9N)qם9R*'W/_B;38xEI9 ;;н(T1}ȅшGX?2oy%U5p{ov ]3tW9D(' !R_nڸcY_3ucY('bP fj=1@/F)QHE"+PG?B( R_)\_tF^&H$@-?P -mS.pðB +0Q0D 3$C|afS f*bBDuaAC}]a^sOT%4хW4{rZR1o3m-;JBk3)QKF5? ,XlAz YSdFEXOg ^vk#:kUF\rM D(0U2Ʉ)9:.|oY :B&h>1j2Ie3Z򰿒nLWvUù~dG0 [wqF09cWm$bBnC:> !HCۃ@ U;R%{F;_)N`kNlL+'4bk#"pz nIs_HoOT/ufT;R8s~ 9?XFD?,Y-O :P2:Q WϜ6Yw ֍OhV tڨ/0[??Y QL֍^Md& 1MAy{$N@>w7mCjA~R7~_{RH^BFCʢUQX/Լ:jeATn ËF,Zj]Ԫ5ptn6!Uܕ!F./$X_Tk3C<4P4}w;p!/V(\QPjU+Nנ0&6D YYW'Zs i $y"V5GVu<Ձu㓀t=[Ϟ[0|ݺGmVV}|ı]0 f:T{q+7\:47ϲ_uwWrmmz2L+B _XRi[6t> Y׵53epw.\cM9ʪvMzSN1>z%a =mGW,Td%ߗTUR8Ԥf|P f 'oFvv6(WNzV~U4@s̿)HST\|^A@਀^w.t"P{T( #.[M$&FAQd+,_l`%VvY~>L jdsvw/+_ Nj3㓫ldx qܪFo#ņ [ Dp}T~aҥ/m~taXa`#0"DbLwsrrG_eFfKlnB4&K\1yǬ,&I\A,|5%s~,H#Zw]yLڱD96δ4!]˸1%ac[?v h!Ҽq+I7[-٨ bsW5NV]dӱ+$A䀢uwYb}} HHői`T轝MbIp~~pU؊ÏYqY_Y0`/WE,2jAr\YRʀ0^^8pǰ( 37| L9A o6bWj'o@Ywn@~I%.; ־'GZ-ܔ\:l+yIJ+O~’ϘLDj{F~ G||إ[n%TwR>_bݺu999SW%* w_}nEo~GT|?[T S<-׹9'~=%e|/W,z_'֞L}--G[[ζ_x;:Xa@4i'B~k 71'ˀ+=n7VOGICӋȵkG$_Chua4ol2,];w\~CdQ$ b$mg<MMch VcsKD* F D*h̅KD$Ҽ+yȗX?-۽bo?{`\s{_x4-)^xMٴE(X~bb׭#\m-d1֚ݵ- avF6P26ן]^ZEq}}5T/ _G5Ql̞ ]gOm"ISjcʵ!ﮨ(|UAD1E_#bB7v/ζ$ Tfflλ[ťT'è/+>+CčAw]|>t,u 6m+]쒞$FFUˊ|`h;4\rk, [~O%v|_HF{)=nWx3v_Š6;`^Ϝ9y ܌(CX wyD}N@G) @ҹ-KQke+]Ƣ,ؔT#AΈ AaC6~نLx- mŠGa*C*dT6z}']v|)󶜯͏~564 ԘHRP;[dUgT@KeI.f.ׯtqeG_^:c~βKl=z⥺+Z G(4`EJ}Un׽=Ԩt&oVM%-$+y.]ʚغ#gim{aΏKJ=zҥ[McTőY qݚonbSh$ʝʀv.0 h@/ Cp<Ӎ:HF0mݙ+J﬘կoڳѲKϷʳEFdBbeGA@voMTStJVR I;SË3UnP:yA'ҋܢ/}WL\g1UؤL|}L8aޭ}7e2kHFt:xLjwz5ЖdpLO8`ܕ}RX=n7jĽQ<}ٳA#9 ЅX_onypEUrX nIM%~(0D [ΖO5.aQоߒ^P5|w⅄+ SP؄Td7ŧAv…N pott 3O1߯~US2*m5>YegwRn7gJe:.S>v)u?S{Dy3m6D! Q`4G+Ɣ^nIK2[Z1GqSkSj_6t>;i/ŚZYbtJ'cjĤTFDAٹs*HTPamDwKs#"0O_XlTCQ`CbtU=C*-9)Hsa6P؛,NNH9bI3wTgbEҜ,Euw巹^=SfTIIe %lOYmiOJRSRA•ZrUeL? E0TB9d齀 Od~%p/ffSO*F⒬;P`JN]?gCs)8U_|OO93p.("gՖZnK[\Ů2gj-2$+ŀĕE2 V&g'*tU2jȘCDzW6 ׳%ښQHLVR+U)IutӾJfL$zD)x\£vRQ;XEd)|jx_'(ڵkD)~ aO3[}C(0DN8Ƚ *mYE2@=JNo{3u JguOzi_7~XI C,Nٰag!ϣ>/vhb&Hmok-$ çT`R !hgP%+:knRX *&D)+$V2jL WrKhxf`Aa: U^(0ݞ uW**>$)Dzd8JW!U8De*1\&+桁|gY{z! 窀$r/oq^gkO>qR{{M~hp a>;`̇C?J' P3.P=k^%rLXL1' d$L4 Q-^VcϾ_|6k[ +(>xpC+T:^>Q\]j~:T}3TW(ve,l̬2r`e,.zo,fTZS˝,64# -}o\f̘?\'!2Ux| o3bLdkVw6Z?JOsOFҏb39w{ew?&1܎X KatEsWsʬ{,鑻x9w/~{o>oy7sd*Ԃ|0@Ea!O%5s4k6DTwF'9 imZ5(kƕ>i"#31UC Plzbynu?MIAg =ɇgsf9XQR ŏLz oVf?<ǘT^_WKZ@px>$# ?WU5lT\nHK2ePC?JXVOOBr6JwN3GhIDcHd ך"4xug[`pB~B#8\[*t]Yz#uɚlY[wWd1 KI4yujP =nsT"(!b!A?(r˸E,^T|޻sux:x6Lzm՜QoU_y([KPnQ7k_#^oUsʳrE-_G8Nnu&2"uVuwNS6XʸQZ}A6[WF)O)f){H2$S!9Xo18B = YC40i=ΜrN*}KT9E6J n~Qz?=mV{*޺3)[nSo9akDLzKk,Cⵧf'CH9)c1dbg!Lk YBMSE SqJx7{ͣ+ʃrǍIͱF{eg-\R2l(pes8j%/ƕtd}m||y6mc;`=U-x^ׇE@9}5VI/s'מ@Rw60mkGejµLzG+\ﺨXIQLUh5VRgbtU)LlRN@V2R7x%?CL&hOݓ4KDn)ROMI_z3rzTɦ>¡&}lji껤Wh>lpKSgQ :F2)e)B zj5;DʦtLwHBLQG>L 9T|"X=$d˞| PLn[=ƺ}=uDJI Z7詌됃R璺U2tNlq3y,ԗpge[ ј/ӞIrz0}Ԍ0#TgҤNJ#McF0=RkJ< m"2OLzWy;xDO'l&ܪ^BnVy|q׃ԛ@= {  >oK{iEELk{R\#@8%$ٌRGVijJc֞styW{!)||2|򓿋P ཿPDZ[椚և[D+';y_ЪyTjެ93n0b.5Y)|Di u*3̾ʏЂ{(Rg,Ζƃj{P;iN_%7o#F0mv}^2d4I0.R dePe_rxWW*n@:@KVg.M]p7PU(Nρ12%A>nڥzh{y;/sg` 5 rZ cS+̨JJ}ȭRY+#.Yhx qHQ&=(t,D#u;YRqfx0qQ5eK}70+EA^6NNeԚYmr*Jar<:&7Q6ZYeF\H#Fo=uZsKƃO,|ac#t(M0iK/3 zBCU}Nd5||E>j{y߾h+ F)aWO@ % >oG@O:p䕶v`2hJdµrЏs⯌z*Fh/}Qѕgg9(fh{) ^vxt"nܿ;aTj騽J3_eá$S@;j&P 3`bV'Ν;WE)TmۦHkeE:s$< PJJT.>vx+L#ԊWJPQIU33GVՈc.SRx?G╆wݳx/&CǏ:9/>yYs_Y&QG<יgk~3^\̜[;um;w6%466"IdǞ ؘ:O<;L\ܱc/pqg'=o=%ٷT dү|t3/fϘ7ŷ~y9 _{WO_DIׯ5oo,~>^[q9/-H.U744N}O{%{Ӟ{eo]\.T Va(:|[ch-2)%dz[~cwA8{RupVTT}*}8$:v-ٹ/_ Ld]=g/J{j3/#o 7w"4֠qH-Fc XUOEjf5d*ӔQZ{D5,4\'$g,zؙ:XܨC[}8K+כzͰDs1Bk2:Gh]S% 5خBrL/^mI>6wuɲH}2MZ Jc^rDaĝ]?mӐ6!,d ` i28s>mދUGO|]dճ"-dK4xuyѦ1xSdalDzV_k# Q>>y`O ?:`a[Su_|Q9i^cB%9/'ֶDO)MN}t.rGf eI SI;G~gA-/(Q{wRA$?_bUtl^<}TYA]]vg爎1-&Ӟ6b\pO*tkm|eu0- e`E㸔 L$L}%)%;*I{$`7:?Ac=7^MWRYut::֑7`![P)2Z TIZ=rPCP~+c3coa":2G`+n0 C)J<_p68cX/psX#pZ %Dg ҚCZK;j7;C9̇dom$CΆl-r1'`XGM@_I0\mn|*WGa5(bHE R6N+W<3/%쨊"2:Ō(4ZZA .o}?4.!aO/3hH3`-,ɞԳ7q'5ft%ΚoSL|fDmAq֔|`bPmh jlW1BύQ+_ !!f*|\ZVvCSf3t@DቂsbE;iHG".gng7?4ĖSNd{{y|Y1f6lGlXRv<վ|H%\XO1kQ?'OΛ7E )*\'^ B]P`x Jzɒ|t7_kb6x4hI*=:s.㉆a kD!\o N4iMO$ ,l=&OJ8$CdM'#a:#L6T&߱"4H)Rb NLpiQƔCJTd%G+rEEe% yp"֠2dƈ)f?n e7tn:+F*i қ|^Z kX+⑾JFĩôPZ@GH'Ji  O&%+iN4j8:4a&&+,Ne PȺ9D&Y⬩N9d]9sN`\`:/3Ï73f<5㤆#0\#57 ChQVq)s緷O/d@E`ui^BaG@A.(IO/?`KG$]*:ϼgT%Y{I=<] N4zYZE@op tn:RcOxj@Yƒ$GHqnW88\ۀmJVF-9dPKX'cO>$.0زȔ=$Sm=0d;?zY) *lղܝ+˞rT93KR'쎗_mڶiCJG i8(9DӍj`{I_~AL@)lRU?$G&,aܥ&4[{Teko~'*Jx"V\5ê]]dܓBG`~-Yc x)Ͻdxf%BaNc⎻HTD`rW9I177Y]4L~vtM[|9\?̐e%՜=mkNxDW&N'1'3.Payg8mH9< OHSJڔ&MS:GzW9`k iSӨ1#[pԹ^ycFHC5p$WwvOF=aZsp# IB$ )sf04(=>` FX֜)@mDt"\cMWeV3Ƈ~ 7I z%wfΥB#eUpbD0eDXMH07eƙ%ig=+ EbA~ٹ;Fm3gX1QfWRJƤgM:ΚhI4 Ѓn1:3{ZCnYYU?w,FO$?xO )9Av$ZG->;0LN.`Hd(.0'[m2ׄ2k:yҲ]"lAQJ)v8Hv\e#WP4'ƞ^,uKκNQ 5r3 &Tl;r'& 3 י2SqkOș8=`M ZI)F5PU4~bqcGN#AfskY?Po62NBQ&"UBr&N Y찑g<V(5"o hv+#$򉻱p Ѷꣵ>1ZD/PQE(-EC%CJё\W>_RQ~GQ<}RI=L+mxfI[' D6a6M0*QkuuY% vc4!B$>\,dPAUD{!eko)Ofy>ע`+Dy/*Rh}ˇ[( (5ZO6/\{bΫն){]Z-Y9* Rɘ"q-Ė\Y^jK+:2J >!]JvyzNUK9L'yR 뗯j_>w|цa{Dj㟍1٘U~W8 HQ*QQO~իWen}q7ف},@)d,G1mo,O" ~_f-x=&kM-%Z>rEwR4Gd]oX`j4 uu]Q5SM~jbA#ohdl=K6b.jliq!%Rbc5ƴ8<䬷?ddr`:W#۳یԶǔ5ITRimRf T@ROX ^$`XD$eU$g_DV?,ɈA,`|@|6d*#4"$hםsF 646,i`*V.ASMpmc @IДΆ 6J)/_O0Up @˨04?_>W4ju}$*OW(_E!]e(2:uoFkQ 7>"q5^̃ױH$A1b`A qe{?+XMi3@m;XLiM%F׀7fWe5K5=(MTf68׮v穋D$;& ܫ:_b.왃 or}c+~%/O.xd)9ɓ*R&8Ɨ8W;'W:&;'9'u/N\>uΡ/}ck7\پ`uC-λ[y[%"Xy1߲(.|dn%Q}K/AZǂC8*sGje͚5L%ˤ's+O@PcګPER#@Efh4ОHҏ2.^kbψ5R "kM-iRrrPxCgxG}ö84e6zw<AFppm][%b yf^(&q~`y~)H Vt`EǹROr[2:&3u":7h3iJF|b$snDA݉L RNvQĠMn\d+ЊncQن#-p=BĊ2ɞ/=]9&XFavj{G?W%Kb Pٶsw컾cOx_Y**&`~!kt Y뵶6̤E׍4?NkΤߌb>BMnк bsyA>Z 0 / ~'Ps/!g^RQBc KY11S4$qf1OTFZ]]ϼ*V!r2HvSg`6:.Pyµ6*cTz8>f2QNwǼ* [/ȩ2pM'Y]>6ƜSω#7ģC!P]tKtE/`bM% VQ8v:4뛎o>v{c-Oyu6\jo IQg=%fO}Iu.VD(+Y)jnPZ[p D@#UE+O\5k,(A8nX̍MϞ:~o>rY(K.H$Supw|."?6N$ޤ`ZB' L$*ܠnU;W_pyT:5LN bdt۰_UBݞ sS] ׮z[Aɟ(򕩟T`tvNxJխS%,K g.7$?P$yLq/d-ՓA(!*F A[3.Xբ&ԏ( ׍ْ T(΄|Jd/P͈iOexBu[,RPAXݥ00x)Lg$IcLuX-0+΃ T2fwX %mBRS*Ѩ6B(Z ֣mN(o'OLn:v<ׁuf2RӰBb̚_3T_s.y KPՊT.rt0w .d6F9ʴEA.iV W~dhE߬WʿOz[r\dDZ` (EgѢEǎV6rn%砘C ϟ9?@ 'PQoѿ`CQ!Q !|Am2@9/$T?p?_KBO0᪼ "< @"qk]ISBdB18A 0$@}u?.#$QHqT`˗c\7\iӞ`RRpQCoc)rqga;P FZ(% } x&vцT\Aŏ{{;ñcKSrÍ.E} `0oݑ2c-2P"?ɂۮsx|76*LP!XKعA̘1' =X]tOHdnQRcPP& YtJU/=DZRV[@x)Z˶A\Z;4Dd)\ *օxZDo/JDނ /3DXwׂp=Zeądl;}qt񁂱&Y-%҃26lL+;tvtMAQp3G)}3_[4M>~2>3 p*aLD>#gP%2>ZEUp=S'cXc!o~ (t)OWT࡬vOƊϿޢH=J|l=;pL)#d0aQ6:i͑FRp p\mK3f<^ԧp38)L7׉T)L&cl$o$SԝsQñBgGh +_~1 Nř(.ź!CJN[퓟2*!1Zmq'"4ypEӄ7b"_&ΙUŚmlI'p5(2s-d1Jy˄i :at=NH41c^N7@x^{0Z""}'f%R6W$YY# ,mQA2C2iU$7BSӄvƇl/$clJboH=f3kҰOh`1٥J?:+4 H 6sʔё^fcj._|`"4 ʲᇭԚ2P4HC Itd`JmSWPɿƚ`T b-z@QHf3fOVP>u} S ʾX0GO#Dj:p'>)2vXw5\8'fQ#Q 'O^DT;wK? ƥkWq E>x=~@@@1O nNDܷJ ԆndEz!"h $I7梗DEDV3bvu'ziI$!Ԁ'JykKoDq؉Ni\ڙM˄@\ǑX0_Ay"Ʌj_x̓0Dj兔KԱ.α|BǁLhLxld5= !:DےliE M{nai6ŕkdP 5^YЈR `Hԩ#>xcwN=GQ-)-겏F` QMDF ICD'u ץ?P}NGrpk*!ÒkV%)Ⱥ\fFuacu4$H _21 x`*ũ>T7tFfD#&1$33H#VH/ɤl2U'"ʩ(j070I PAϒڎJR7êgs}1dMFJ0,nvW?rL' 8#a* 1ʧ≤L+q[VQyH$8TqQD%h + SE@ Hc,mi)" ֙>ΙPe=?tw,o8\_QzpNӡ8\X-lq#ӕfjϡ[D%QQoP`WxhuD_+{(v[#u4$& :g!C]KrWGjaHC9ȑ`jܨ " ,(p&Eݍ->7$<R#@ ٫͍7>""i+&(ɜ9@`>칉GD ԅJeB4wNwʃP H^0IÀ Sf E '-^O/ Q`.JےдV4b[+V(n>+ J2m dJĀ.@7tm=wVW{ 3,ѺA .Pt*ゑ%YX_RI2nѡIBM Eck"Un˗?C` )*>xGELrr7|rFubg6`{X]o'qVԝ;uJV=*LlHT}|T>$3qT"uɮd buќ"Igⅽ"Q\rp W1q%u~Ԝ3/tv3JRm1z<(X뀿k1"?e(ǐ E1NAr*;t<֘f 5'uɍ- ~ oۯ7<VOVdAs,{.xa%0Z (ܤY35!(rCc4M׏},H3V1A O?} ƧRFVĮ2ؿZCyę]2مg LPGd6w)'jO֫S?, |]@$*HTTۢ8V'+'+fA{;Ƣ!sLj "q({z^jg8g T/ѻ8:Nf-]øq7&ݥ덁Mn͎ `B9Ŵ/c3˜bqƏlus#؊u"8N =8c(R6dXP309Bĉ-tȭ:{P""Ӥb1v*03u~T?H6tB?S:{Ӊ'Ez0 25:[8{ȑ#jQXs:ra^R'@) \r{K P!=n#=mYӞN4տoY"ZQ<6V)K4$%g|C{ܾr!l ް_]jDUIk9O [+S/ӱ^#6"IX_e, ׄ+~sahh#u_}ŕcSC>,2o{ eq뛵UBΉ5,)!9`dz~߽ǜ>>2<ڞo4DG t$ Nĭi+&BG`Z*X>r.>Ɖ M9g{`Ј1g۽`mTOPQ:S&(:-a,Iu/Y pヵSϏ&1ܚz:zn ] y!cufEZy( #g5Κӓc%Ike6XKˮnYx<6$;N 6bGXI<ϯv%#Dcep}fc'& E`psQ}"Orn瞴И 7|ˏ4&ǘ sTہ8wѦXe:}El%ZP^Ǟ}*ȭ^0>M2I{wي DSA]u-+KL0& OE$4T.aP/jRB' () *τpXG|8TGpv)hE.M"gL>{K PA#`G",e9ycun|'waq}Iĵ3'>iM'Eή krHah.KzNkI%D=UbЫ=Y*4pq˄AX!KP|k-fHěp/=J 46"q ;t?waT`Ch;3D&qy|z^Y2Tv:ZR.5.{HpmJIb]ci@ 澖 rK А m xb~,2Xa)Q^ !hmԫe@8 Rx]J b]e&LgLkˈچ!RӘ}a1Cu^_@꒷hՉƙXV ?߱|S_ T~7#L)O &5+@ ]1 u4v%?W=s&#p JcU`n4ǹR%pfp(aZXɯH2JhIr?H ]Fڒ%UP2ʬ$vgBdod EG<@ȩ$ ;0N4kR'I$s4*pbYoX;͐Y7X*CP@ͭ"C@(p KT| R>s>sA0S!Ti~)I/ڥR'knrQ+zS~ PJ!8,ȖK_.N@r3id!6H.9Xq`DK02p%(UCQ{HMQgS1mX\q1 !Tg*K]8ŒLN3&K,3R| O Y@BV!ڈ{K"T(CH͆&9ѐoنwmm'D(e _N:zINQB0|CRsY?CFuT$/ˍ6%& x8J3ȷr2Xȍ(Հa S~0-/ 3D+Jt;vuSNxe}f~" aՐER!vl|Py媍["1Y]FU1؞@& D.鐆lv-.NFv,5&( 6AhHl4No~KA$]ln f$ XaE =D wj)P2\H:EI:l ̇+V{%U {(c_'$ӥHz~l:MJY!0bN)|УzKpduNPpEUp…%%%Ŕ}I<a/(Z#HԽއ?A)..BZ L@?, .:0ƍރ?lV#ݯ}pK2$ qw2{#sp%*=0,8:7LJd".(rHF‘fg+L)zɁ9D_mo?_Q+ƙ:<^-B O0 kYĢwlfArs'I|yǙΨDKRJݻd8~Z~rH "t@qH}I cUkt(c/^Dv݈D#$٨ҏp<~9UaeÀ'(<]fΞǢ@%!:q`' >+QPM|n {/y[Z & פJT}GQ" bE2C$KWq{I% [p7?m2݌rF" Cⳋ?,d8|&5g8D$9c AqIHFtlmSg?n|yiWrB`+_⚵[viۦo^{O~g~g.$^;^(dpn|˿yݿaā|Ӯ#~Ά|1;^2iN1zˮMXƋ:X?֯Y|Xɓˢg} W0{uMt߸[v_uyaE4s ڶ7lͻ.l9WYi˶_tq2y %burp%[S簲3>7p$LpȁF}9|o΋"ᥑ!W`m`W]w+0ؿdvW/UrSOXo<f!$>f,oצ{rϽthg^9?΀ qٹ3vhH=ovNV|?JGE陉LĘ=)L U.#3 ~<P-6#kكO:2/th G??w6?70u5Ƴjtg~'1Z`-BN#h/e32}F&EebMP2Zu"bؒet_!ܤQB)D%焇XD#7=AG^<=rg!n{m%NBS,O"23s;\qLs Jhے(Ǚ,='.NC:~n󐁍8aPx뭷~ӟB9_|1ǡ+lFs-ֲ82A\L^x~ckq؄$dz9wf:| *BmDQY[${=%d.{{EOXiBi5]z8^daei񭅋S3@0zB{JzJP !F_ *6.͌ ~fJdG lX:^D CWr5{P{؎b27AJ2&#YTh| IT<$pJp 63SNp~+= "^NWxHFʡ ,C{ӧ%>3xRx"@>hbl/+CP.iS&zzPɯW6|ujs c/$B&$pnv}/xbT-YRUB`!@oIpFAw `sA:D# \syt{~X~,#P4>`*r !)X /3%k%VnoU(8Qq|ۈOhn/[ⶬ^a^䞇}}/]k~Ev^}H(VR '2hy螲` a >;7%udOI[|Np*X!aA3>8li@',y:NK]( jb7euCB{b] E aT8K!Xm|l=Rݔ0B@!hO\_Mx7i+KOIк Ƃ-܂R;r}Ms׌O t)2IQ4MÄoTSB@! V)pB;? \y啄$,*S|zfBDظQhݮذ+L8'I?1O˯1H! " 4a~3Tc9(#;8f-B6 pE@T156駟 -XúN#ZB!Y.1ӡ/ˑ#GdXYw)f-,HTHr>mpjeI+ $FR OyL:t/hnkk,c=g׿޻w/g}^zX񼧧WہyEl0R$_)@#?#_fG;ZleF.eAK #g+IN! Xзƍvo=7=MWz !fg)hD$ry[`n 6 4*١k3 kحKT! B`" B%4߱SXOwg!M^Xa0u/}VF-J$! B`%#(a-i\dRs,f\JcڶL V2]! Xn0p#jjr1ә`:'1QبPWdqBdQ#B`  (R:ZaXÑ4E *#Cb`8uD-B@! ,IĭJPxAIE z *8vbDn\GqSNVMS! X`FYHLQbIQba?P;;mk(᰻eQJ=+ 5@! XjTˣÃmn4 Waq4cRRG{<DZ_! *A@-pB<}]f4 @q4*Gs(a(2'ڭ ! B`hhYg2p%B@#>%&0M3esz&$ R&FaSï4*+B@! >P( 9֝wwEr| g7;>5Y ͰV4eB !B@(\@d<16׍8sRũ_qre#2B@! SvŎQ{LN[mQ90mHZH(,B@!aJ1(QЁ~8K!2ןm-=q>RkX |2$B@eZ C!#IJDf!%?י eq]JBˠA! rAG2=S ct|h6 M $ P3'M d!00X鑑g&hP! лl?h+$? g./qJ)v;!I-|~BJd&(O8cpxxR8pB@!nږ5Wc5襗lQ$pV dylt?Ӄ?<*|g ҤSmݝ#C7EED! V 0Xwt*3(g;BI5)I"WOQbE{VC( RKB"Md)3n/:Z:2|yC|%aM =qc?poEM( 9e8' <`;J$9:4h| s}FOiR0x+5qscLiN ! *AQblu{K_W Wfؑp\66C6z]JhҀ9CĤl.`i5FvXx"^Ffl$H"p8v(ǹ &''Q! *CՆ{;ۚXRGҩ&ƳbCrALf%ha1&HSށ'IAJX>ՕnGa:Q mfxxrOq( {G)NdkǛhmWEB@! V1Qt}2g)}ހ:z8B6ޮ`q| h̒e:VAj)_ȍ"FSuJv74D%Rwӕ~6(`L07# B@)rǜᄑˎHg#6#9hcRh=5܀[g*JB‍hKl%i?9I1q7FĦ%dcK GMQF! B "@U v#10tJ g28'sc"1.SVIa)#C#ÃCCͰJ1B-3\%% D.u0DQ L3D$B@! N.n|Ӿ;dglev:tʐqU )BDǝ̘#OG`\OT&ɽ#*M! 0TQ(L^".IMsHw0 [zpJyLr`VN->8E\Ⱥ$A}04nb6ۜD0B@! N. dG9f*'t`қ>{xk*aw:lAWspz30#;,H)!0{DTNӨ҄B@j<16\sA@T5DG<wrq)! B` ,S2 ١~I#R1}Ƽ1U˜@B"b-LddhןȎTY'6 ! X0e*̷`2jp@A8}ko5Sfz360IgvlXu;\DG <ГId'(؈9ԅt h-Y%νDGB@! "IXJ *~ւ1GZ.&LJ3 #8Aܰ87&)Q:N'UEC9>0zuf4b L%d]ky{ _0?nm^B@!U*Di"].ܣv( H`)>4UIHy .RP?P]grl R" ! '(Iq k$;ha R ),e/53ȍNvR F49Y%Xi]M K.InB@! VyB-Hf_$ YsV3a 0mI=ƉqS~ҰB@! )D( +di4Oc$-ɼ*"B@! B@! B@! B@! B@! B@! B@! B@! B@! B@! B@! B@! B@! B@! B@! B@! B@! B@! B@! B@! B@! B@! B@! B@! B^5 endstream endobj 11 0 obj 106703 endobj 18 0 obj << /Length 19 0 R /Type /XObject /Subtype /Image /Width 281 /Height 238 /Interpolate true /ColorSpace 8 0 R /Intent /Perceptual /BitsPerComponent 8 /Filter /DCTDecode >> stream JFIFC     C  " }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?((((((((((((((((((((((((((((((((((((((((((_į'բ|gW-XԵOZh9K[p!6!M~X~ӿ\_ؗ}&_ OWeռ֚VjnV l"ddl_75:-:iPT" mbcd`BH >-|+L~|Jei̶Emo4Hb)IG$S(Cg0 <74Gu [X2%AI?߶ſۇPt~~|?[6F WrUIE=!$G?*gGGu fF.Q q-iy+cBTyXRB_p).;5C\@2tf7ߖ+bsCjmzuW W/[۷g|qF;]ZmD([@g<COpɸ7F-H?audOc{mg/ k*_F!aXͺ0KJq'??e5_%*'_9h?!>ST3?!>ST}D~e3Ɵm+fx|4?i;/i.,#[׼c%<n}~ӟ:Qg_4 ^[OkLֶ?A?,|GE8@Z(E h(((((((((((()_!!k?:&h h^Ov|_Aٯ@o!gavY%}HYވGit6/8 0>~?(jKU9WO6s9~o⏆ef<1H=q絊x%U-o`7Ugb F9sR%:oJ̯?9sR%:oJ̧G+0S!|?dOZ;ooŢ${[{?сC0F7a6[?=QfԤ; H!JE',#rK Ip[6MwIhL[P̖^XPѫ| {*_LO q|85kLmn7ݘHV&k)1mmw^ܧ,N%üAj&~%_8rſn:ڧ|e;};K#fH+$dA7|Z˕N?I>Z<%e~oq>ys^Y1myyR$41y^ /$I Y,hd/ffs<V|eDhz_t_ Z;? ZG-ΏxB;EsKVe!}0:Vck|]cx'J𮏬xj$Eխxe2m.C-Kmt?IK?~_\]jumw:6o2حE)fU`|HZhoW'zxn⯈ a<4[yHK˾8(^@m!o0~<|vf 'R>faUɱy\ w&d$LO {?q?~xL K_}7Dмy$v7#dOڷ\m$~zG;Ói"Ol,&CM`)ɗ ^LydGLe~"~-K}g-淚 Ֆ3rj::$B̡y/636~4b"[}/$}:I~}iyl!+YÁ,2?q ( ( ( ( ( ( ( ( ( ( ( ( d .xg:m7G̗.}A֪?g ]M/˅3+q>$E}&;}X *.┢ߵ'd?k6`,I*+}ŝK#)P̠O~޿Nϊ,H\jԚm!60IY"X<Ǒ浺x~(iaF&lܴS}2OugM KVvv*ֱHm4e`o[i0-ڡiu@>Zw+ֿQ-j`֭!Y49>!'kf$?+?MsY% Th%pUl2B%;*W/6ݏ~hW_R[x]dOB[! ;؟3o\M,e֥~WӋO?s'r3_gtlk{| ,!xxbin9}2;;x#7UiA-_!?ࢿfWL[cg8Pы[D0g{J<\KO%.FWTݚWўaOG:qc ~~DrͬiQ_KwHcWA%+qXB_hq'](x"Xͼ?n)fu ?1-L#tKf{隞iƏCwgw Mkuk(9`]I Aa#B`E%$qL31V])I&ɨ8B"(ľ*6`vEjyږtdݸwԉo\Z߻2~^_?/|>x/𾨖wW~ 1 r<6?7# Q_~2~'_l} :^#"OMoӎ~χtm8>+:mn;-LQaK69 󐮀8|ccO_i|Fxf,2<`E!E 2ZܧoWy~û_oT>grU\[i$dsn M Te,;7۲YhSW:h.DS] 1͋z7oğ~ʾ!_ ,xI`de[[p[$bG$H'(Og?h> sΏ{=7֖]OǛ2HRDUQ:t2<?>3c?j~qi/K]&OtOL2&r@_/o|χ~?uxNn:ǿZw@~Q_&3M7׊7B%iU|-$ T,4&7-~_rwsxG~k|NeJv )eԪ0$,]=E~2okIq+wiY%x2S)} :E4k?Iyϭ7Z3pM!ղ?3B"Ip>?k 6~Ǐ5֡0E΋sꚙ#A42F*W?:3FvK[Əo0U\jO0@-D\u\= ֝ڃoH,bT\ Fmu%[T4 rvG鲻WY%mI$NM>k[|G:n5SW)alP ̗p H SZ|Ww7"MߥPc|\J_BG(h |hu|M>&eH'XR"c^H?e/!i~{xW^Ook0wmAqd5ʷ _Z9GIu&CwO |"k>5ޭM &GK[hZiYTr"1 9'^kڣ\wXU+ccf.XPXSb9gwf\⦣jwVMo!Vhgլ2GR:0kŧ ?M`7cX> *Q7>+a4i%-!HDbJFs>r,~"6_GL4_C52[\E9pT"E @]V֙hm0BA8cPQl@Uq^NJm'V i?hv:z#zm˴XMѹO*,W[Ƶտd]wSM5hVIi ,q6ː?O!ndֵ+DZF-"` *}_-_J##f˘\*,nc9~k?~+| Oy|=]\,pj\,B{JZ9 Fڲ#d&c~6?#k>q=ʯuzkg$e%8HL?N#}S2o /B>QtZ'}**!k4S "D8Ҭ((((ʟ:S᷈O~0[=N WFV'vA#g JkC>^4imV`6-.Vg1Gp҈˘7dGI<|QOY[v+50 #TG ~VUVe??_kusψo2j {U`AOh`]U_p?u4o(ݏ8o-<{LYVHuVSE/5߱{{aʟ&ݷqPisCһoJ(]q=ǖ 3Ě`v&"xCO!_?W'/Rg{DXk7 C |?^'cԛT㽊@gQ|Yc̙+ ~oGzO5 \񯆾7|* =ͭlگ*Wr*Gj຿ (|jCX6/tɣt-:K%%G,@)!CeCq(_$>%]~?O۟AoMPupA/$UAbǀ5oxo2~/xCZ-֥ =3N]:t(A.($)D县O3Lk޿ovnoؿúcVu_MRah浸O$Dlu`Th'ƿ,.J!_?W'_|W>.- dw*Dx ##'o? |SV{OvXͿJpwF#`z" <dwY?loJVeoCi~[k~(fmyl!pEfOE?6~^2sQn,5%yP#8F=h_?ʿ?{c /^ 5]9l4}.n v0Hl"ڿ?۟P?2D$CyRş>Zo5 Oh^@S  *''n ku9avh][k. Z!Bg_>5?i]6Ś]x->f"޲Vi#`i +%k?Lۛr+H6yq$< )LU2D`92?/L[G5kOjZ'ik(uEoM4lr23oR|k_7Kxs?|!{n܌$G50u~{=#G?$dV9c1WFp:)n_lFAoxj)|*YC4jZr#&v(V#*%p0."4)g|#ToQ~%x85U [xbwm;#f%@D>ln ( ( ( ( +(7o^ f;tsMoiL_.tF *Av~CU=6vHث+؂A;PQiqM抖}{Vd)y*J{N7/6|I޵|wuo Mw2B,FVf b{?7V7<_hzzGhӢ05 NG˥=*ƫUcKϖi^S+'7{L"9-~"xL^#}Bz;+aeDo{?Wࣟ|Oz桢KujMkgȔyQ3 H@⦟`SԢ^\+IuYU| [1jNKV(8>JJIϱcf|vmumm-)$R-uaʰ G ُZ$Y^8+sTdYٰ<31 ekgNkKR2}-;^bo)3lf[S+*uƿ 4'gISkZm$6wIs @Yr6O.x}o>33*6u6+ei-떊M$F'k/QNeNeWԠ%]]z4'6ԩՔҽ8Y˥tc="FkߴL><5GDnӯ&#OC3G"{kڏWռ?3|E״Rŕ%#   Egͩ!Ȝundњ|;UY*|r}T5t;+Kik}(Mo{[&ko9tݎqc'Ow8/.5i/#ּC$E=WJߦ[jxxW4_y}t߻̛Mѽn*D~|~~i5u]BΗst\r1&VS8~ ht.Z[մ1oOȀ(‚vݷvݰ<;_ *jMOmk=u)˨1Ԝe ⓎNW Sw¿V>'ow=6}f)~M}O SxN%GeoA|7[,m*m즠wnE|iQ?OO([]_^ xeK4eQ@!{W '~5?|J[[Vtԯn>M>ڛn2|e wNvr^=bW]Y \NY#IJ45((FHTtT~VwYx_Pe^\yO!Xdv=,Āh?_OsLr4W|㻋}>NnɖV4Ası@1]i[/*4i:*(E-Wx3ø\'*4pe&ԦRwm~Wkݫ#ٟį xDjt}Kg\49ھ^0~x<|eG=3N#K$o6AuerKEkG={-?tj#:/X򪑌oWݶp+<0(((*gώ߳Ŀy'5Ojuw1+#l_PySz1'25(Ȏ4f!KQ~fu$?s{0kL$ Ѽ3&vC]A*̧*WGu[[KĞ8mm<үu8ʱ98(k\bjq˫ W,g~̸G46k^աMTUa:$rm5Z١E k}^ʷ|e{}+y |ve3NLZΝ־φxz^ 6-lc ¢@r?ڃe?zuu MsèH\dsdO~7m_o#a^$C11pijKͨ{n?'1nكG_^ qYlRHdXFTyaf@Œ$<7n?w:Iݤ{7rar8🆴 Jm63쑠E,@pa^cg(%?~5.4[nU?PΒ1?,26';ͿkV)M-.kϋ)zUc/Zӧԭ|O:hr&!*dFx 5)OxUi|29/y*1~<;9PBb?R~ ß~&~ҺM[mC m6vE3$Y0|1JAU*yx)c\ j.h6ե󋴣G8'}8a%Xo>hoSNPxvVg?c;xFoh.5JnOyI ^]#ˍܮDarŏk]'g3fMgW+P^KO$̑Q`T| s?߲6*gZ}"}+Y֬lYue!Vb0n[HOk[*~,𽯆Wеk}Nxyq32 J$}H o~?~,|DMkR{K)&h.l ̱m]UW <D*~:^iwxZǘ^[7+y6`dqW _>Rm'KX,lmSjEI9%KI$krv 0odR䷳U%4ti(]Yosxω#Xb*7Q׳mJRԯ's/7ҟ>C+koG,߿͆LLcgb%_eˮw]5 -\7=ՒgEc?k5O5 Q&?7u6>!Ѯ٬Vdx'd,*FqzV7?-'࿁ FK~[Zho:IsF +䞉` /*R֞4lx&VBNXҩ{hvU6~~k'29D>_j;Io6s|3|N|JsoCjwYvK M<+f 8I^e¦t說K4fC d1qaZ*FqqI~zgx+fM<1SzچI-UGu k_z*B>T O? WoFLrHD/,2+xvW`:d%(JT>o1ٴS_?fݖܼ۽ (CB((((((((((((((((((((((((((((((((((((( endstream endobj 19 0 obj 16174 endobj 30 0 obj << /Length 31 0 R /Type /XObject /Subtype /Image /Width 349 /Height 202 /ColorSpace /DeviceGray /Interpolate true /BitsPerComponent 8 /Filter /FlateDecode >> stream x6 RER@ޡҀRE4&?hIߓ4MZ-" HQkۻ眝ٻ;ssf왙33avvf_@& d@& d@& d@& d@& d@& L@1_OHĞpP.#Gn=[-@b638d ЈI a[np--1QYUI+S ,c6 t5l n3࢙+[Y &\ݛ!-OvʝQplQ;RWaļYK1#[ Nȱ+>>{9\lDO.\b m#|BNaDW <>I2\+p48Vg.7o9t7pxyŸƘ0qj8޾8pEDV.X=)5?pid#S W\Q}x[pjlSnKkʻ[)lqa橔0m>M]mQt㴑KũW֎#gƻy &TnYKApȮ-ܐ/c9.^{jfXʦ \se/{XeAZ#fY1P4o;%Xm 'TM w x?Ôb1P4OAG10#Qw5xBWqrl{em\O&0}nZ78cNaFl\'xzaAGƲ;]I<wNa T6.^؅40bcnnTBXʦ9] u9 09%{XvoFr\5M2cܖpJR_l tzm(egەi@e,>u5;^k& Nze;\{xV}{M@eӬ> 56P)Ÿ+{XE6?}c7%cipxOA]Ʋ.!3#>l.^͞iy {X6:ؾ!"].̺ʦ58ߕ԰DMq Ña#/,M½ 4|sJY~qwOY-{XŸsk^JIVUlgwu:=\WVU*{XXm㬁ǫzbHCEʦ9ɣw5g50ū")eG8}pcTz뻏(-I$=],uœ GQ#M ѵFP5mp6ZܖO@_ c‡%}m0njk#=hf]?(/Aە@x[VFq_̈s+$0vJF6(%`+QhvȹVs^3@Н8 F Ox%\3vXcnchp6[!Zm縻?!aN|.o@'GW\WD-"ijv11[!pײmPBCJ#,q0l}kQQ3Evx:i SRHՇ%+a{o5q(pYdm*8x[͇dQ:YsW`XD+k?o*FɢmORI.ŕZh&>>_6շZ΃ roJLK-v l6`F<(] nGKw{\};Pɾ$%㙋?_a`$ QlGsy?ߺx4Q晅-mm3`^۶yK?tmlDμ(tܲ[y#%w#*o/)(ߣ!*ލ7SNbwqvˡ uA,&y :K-U9^ ,_tGL:-\g%\,f#r}o%T~ŊO~%b\!Z]=V)od cbw-^ Nh-Ym;\͔3@y΀T|ނ\]Gyϛ)YgWjFߞ F'-2`W|T;1;7S.=Zj'E94|ނ%\ZgXa`x$ngk-^\V{(_)x,Yg1Fh> ~2`gdxos1a 7S}Cg[W y .p gd9y5;"od\ 0 P y np%]`,e[{bg KsVkK߱B $COs+Ǜ)YW &]ۤ 1[K3֋qfWB7S8[ -:d>o .Jug͔+NC{1|ނ'\/[WӹJEEUs$x,YFw@s -å .Ub7S..n{]O$y !pjtosL伙uAp=-2>[LW"Λ)Y"-%6"[qnS01nYKApɮmp*X{cWm*.ok)QGcR͔nid>oďL.od'\͘H>/m 8%)Uh7S n~Jqj |ނ\BO"y pCMB&˛)Y ?1shg52 g w8vy3%5nMnSO%8g[=fJ91=>Wx%|N)-]GtZAu.pEv^w|ނ\sA3v[junp| I5 :d>o&^_͔sk) 7f&!MȍI09'3L 2L 2L 2L 2L 2Y'd3 endstream endobj 31 0 obj 3503 endobj 36 0 obj << /Length 37 0 R /Type /XObject /Subtype /Image /Width 739 /Height 347 /ColorSpace /DeviceGray /Interpolate true /BitsPerComponent 8 /Filter /FlateDecode >> stream xЁ Pa 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0p505 endstream endobj 37 0 obj 1140 endobj 32 0 obj << /Length 33 0 R /Type /XObject /Subtype /Image /Width 282 /Height 157 /ColorSpace /DeviceGray /Interpolate true /BitsPerComponent 8 /Filter /FlateDecode >> stream x] E,BHB@D1MpHp02 H$BA !l7XCR3h"e 1@¦B3g{TݮW>}ק˽4gSk:"ZWf!s`PžT2;*a5z9P/z<"v6S/3[dWu3鮛%jCԛ =Wkh (Ayaf6Wv S塛kATTt!V%R1uA&kgkL˗JLSZbM㘁e]*Vlfuvu} >.)>Z׏P C4>,a`W(RJC3IsUTE+ZěTku*VTAվR7hR Oz49)aKN%l,BqL3&1>b>)2yks0xG9nt®剖Z*d&g ?W&H[x*ak@,'M52eSg%q6޹8K>5XRh0<5fۦӭP3*mךt3-fܾ`JM%.1[~*a0t3}eZwaV0i3,Vtŗl#A;=^r7B/"/MDC$Pșc\y_ݼqx]Zw!RӀ Wa|B]>.Ӫei~p\I]o1_7eCbO$żRe˫Ŗ?pKc\V8tLфr63aВ>*47 usA:?TV bʫʟJ%=QPwm*fvJ׶YSb) (3 Y3X ]. Rkfe#3=nl+ݟu*a>B_Lz.JC`eKrN^xu3ɵڲ,rs@AL%l]}*]GP'z^R ~yR930:/ O,y!&WLV|8 f<+ b;1TΤie*!^1sS4ڇS}L fnf?]4 3#jVi% 3'43]]-3-O%b{1'Rj fN͊QbQLv`o2#kTiqmfJόZy3S8fZ$Ļ;3_(3C(-JL ʽBiQdfZI:edf]{2sZJdEؽ?9>R:ZTB3Z#[ڽ稚SՀwjر0a@: t0aÀ00!JwH3 ?Eqlyod&&'fKD5SK."#m) \r̸ƶH3D {0 FAyɣ<3 a_)OeFQ#c?}kv1c1)L}3qMږ7:~1$B͚2+#fB]$8\ Z sюP/*f~甼ީ~䇇VjLGU //;AP9ʾ u >DE/V)#|}'h5DT c~ty&bz5f`7QIplcn_"6EhN 0'hxk虹*87^"?)2qG(uߤJgvyPTo?YÒb`6`UvG}g_c#t47.p.2n0g{۝eA*,3w&"a JUn2=,0sB@ vMcq*f\kE9^Rm6X1#m,Oe,fd ڈ;Y܁ݓϖ:?;G\5lO^p'*|ST `ERam#-e325+43F3K_?@ֳ5*)<ѿ,ֶTM|HdiaqΧ\V˙Y ץRڷ +kmPojPY{Č,cJV+ D9`g^uOXU#EQ̾l 8C&0 V_$׋6*Ta3~̆NO4'غK#6Œج4!@XyF@kiV9+?N)4z2Y#Y $qaDXE7 TF EQ8fldBb`]]|h=8gd?ۊ-͏sniXFfdťpNJ1*vF5 GRS13c9!fK &qɯ:r'+ A65"{XsԂ؆ S13b Utѭ 3wr =mDڈl/˲AGv'K|PvNQŒx0^)3K46ݽ0 WHFIevd3Zh{RCkA$x*I%̨˥Kaèkl| xDfd}wI ^ע".%* *aE 3 m_ >o3>6;R|UBf.G"+ԢuG1WV):~dAP%s֯ 6\8X 5(e̷b13cm?a"V_#"f%o~ձ^Voݢ ҉b\)LDY A,s4li?X5(Lt1>Nɹ7d.8): t0a?Xf~۶}/Um\[~ҟoGuR+[JQt``]"e$Ug uNk 2D-r @7o0}zݺY"oYBSdjRlE@*9TU#"Di-z[K#QSX0I*1YyqT<#1* 3kf|(4l%f`zDycPٰ*ĉto؍gCnV2̼KPتz]bFAcҖafjEÿ*DfHd!AZ9{=Rh\Li],_ice *?wIU*;]53{R.:oUpxÂ1.!.0s>5J+3C6ڧ{o#6 v}x-4o N.G̐ۇۑgifwwe6ͳ*c5xyU~QX뎚B,n:"ol3)f&:3&jY6f#\3mYA1g=efZ5{a,,0p~IՎbGSΠ`7֟0<"'.Č?=̑;.{H[_Cz1L%B:aOtYpJ|Ds/Ƈ!`O. &cA #k4n.zkB\g`p23,:=zlln[@3>p4yZ%?=5CeGz0A5YH2>tR_Cx_;;]g2\άV.gm>9gPhE7,l["A1ft(cWld>+PVd61s7}xcNaf?oYÝaFoYfeQv?JWGB,3 $gngܘA3dd$"48͌Z᠈ 7Gb b|Ōr!cfR:.,Vj \0#k `NLΦy$N0Iɷ"f~yٹJ!TNzH9D4xx6Mi7gB9Ƅ}5A.H ^?evW1&(fTz q+0U4UAl}W嶊VS\&q23{6'L\! VDXe̼0ֺ齛OuFpr4C-;5Fmn _r˖-3ݮ厙Ug2$P9`3]cU{X/k)<z.龟0fNS"7\ڦ%Ma|tv4>Tj Yۺ g͗`Oݹ%;ޡ WH-cׅ arq@]S[ΊY𺸢=^h|b,c܏ucZ#KYm7xy{7ԟn FE;Ld܄5!R:Kk;. D3_3WU;vQ9}Dbbf $vuӋV7NÇO¼`V5W?n2C=]P(;`Fvub 1,㬍5!I4Wsecup8/T }Βf ޏ9o;f4nqeY}ʏ1,>MMFÈ_xb89" yBgrM7F*kLob &Lv#^2|AqR6X{{4ՏW8 }wLOɇ;-xɛ endstream endobj 33 0 obj 5762 endobj 34 0 obj << /Length 35 0 R /Type /XObject /Subtype /Image /Width 260 /Height 188 /ColorSpace /DeviceGray /Interpolate true /BitsPerComponent 8 /Filter /FlateDecode >> stream x]{]ӕ?$$ Qx!C+PzLPxjd2ØR1z^ jiJE$I"[c=>{ν~?=ܳw}wϹn2C<#{n;Q㺹nMcukeݓlf?? sn2!TaZE򃺊V_2;:ژVI9U{R'Kˍ1%ҎQm vfɴe_h$~4-D3^ =lXɑhr!n۰Tnb+Z꾰Dl+y+tvmkvN w@\QEMu+/ÀXӮQiFTf].=O^QWjО`ߨmۓ+OdžCtQ9+Du7SU ,k-ZWBs21YlzÛ%j8/ Ff9eGexA#_/v]:Ns-~>Bzݠ;!Y 5vLbZ/N1ֲՕ U]3*sa6sQ'ٳ_azlF]5Ku6v prɨ[jWxX}*| U.c9_*,g63U‚DZj:!Fx]6^A3Em[֠K `M2F2ܺO5>7~>4Ys 7rjX CŸmlO}>mRc2l;Pĺlj-t|S2iv3%c}ggp{"5EhM,<.2|5ِR{JO Zٲ}lEl`3qO;E Y'Ǐh0L䃇((-p'숖E xj1貗-]p^5u2թ,)!ku쁋K~'} n*ÅϚeD _h| $C03=F`iwk|Eְ-k/C哫[Pw^q `ޮA Lj3p{G_!;@}![ê *056hLΙZǸ:NAN~Of|@@{y WW|Պؗra~"5v.r}~ ÚW؃8R/0;t e֛&c6>ZHDm]s@mznwyj=eR4|3ߡ9⪊\!hGuӢ,\[@ #&]^g?ja>'м3h1~ qMrfW6LD+ۖc>K;\DzcpNHwiKY9 gQ&Uq, g䜫!p-֐QěpE:($]fI;/OL-x dni瀦JD0EM-ۗsk'19x۹w__sg6u6~J2+2 J$Y M 7(S =pVYdMgz;'ojw5NMNZEӜ/HR=~ijW,O>,O@1J!v.D@L}~^T~z<c1(+6js':#³٥= f -_s q <%\{ m.`cpKKSL =0+$r*_erH(Z2n)JJFu@s, 8?~<ɄMfWbJန^(ܶ5p;Nf CģD{pF0-Ru_jro[^iq̑`Dj[&oMAFl{!7`thёIyOpo⛢R5BRjCpe87g%!K3уŠ, Z=HEk՞UF -r63#8̙C='ດU B6E -/G2:&̕fƱԓDb> cP6DpoSu0/( S$Od:U _X˙$8ki!0*#vN%|TX*@92)L$M x 7\##VL(G˥,`hj_B:(+%-U{S~Ds<26_ll /l͍㩭.e nRkM9ZHs7e-+4ddp\N{Hcd~B pjdKvџtRPkQ- Sec|mcfzx!1-#8!PwBdm`?iJel8#t5g yK8JиW٬1b=9)q:3L48V ;!TD` /}CnSd-{|@>"&ڶ =`XWD-_%}%)Q#s}Lk 94W$4)MSK*z;f}:ʷ6yu; uVb`R.iJY}F_nAlr'~[͔u`F<cIDfÊfKGtd#Yܷp~`ilC3TGsJX[nkNST7ճ7=:Wa%:Bs& Frv;NN\D)&Ogנhjq &3mC9WnI=Guq ģ1m-]`Дd&~V}=ڊFB'mĞfBT~EU2bj=uBE06M=͝vW9Qrcp!}IHR:/QK[`'}{KE>. ckgi$]'m1某;a{ZȏO lHN]m-o0a*qk">j_a[|$0簇/|+L>L˓+ ౘe2O8UeUVU0ed_?c4C/m 1/-Օu)-d=| sSv/V1.@?O/4n0lצT??`f/1FXSf ]8c7nvB(_tWaYv q#?pO[~.ur11x7#si{ ]bYc)J/3|?Nk[X$X~d-W,m4=nVe0c;4*] /|.=xm#@ㅥ)E\?%z=O~L0t5 ~At9]q{jdE;xѢ1G!q޴盔hMq -KV91>;LQ1uNiw=pWԣrL!1w۽oub<|6|O[^kS3x<:5sFt9T엓 kmln [:9 T6Yipͳ8q|"/r2!Uju{D?,U*N'6@9YvtF|ٗl a6dvЩ{>DA?!q.¡z&ito<<$NY.p\s*qu!hΟLcpSnw:uE>̤guC cJ]JE8 ~drᏧw8[iy;-&k8@$:z ֚2zWHCv[ GQBb9^^ǺZmm˴Ķ&:o/I((]5>䈵"=sNU}Qeejbkm_^m͎ /xa[ _ )޽kn%_kQ[vH7TᡤΘ:=pc*Zpmt KNmwe|ZO7]h77HTYٽcP88~ۻ[P7Zl2f߂ >gj{yӆ5ks 6oq~a3 s{)wetO`,D/=f0<1idtʼn endstream endobj 35 0 obj 6568 endobj 22 0 obj << /Type /ExtGState /ca 0.651 >> endobj 23 0 obj << /Type /ExtGState /ca 0.302 >> endobj 24 0 obj << /Type /ExtGState /ca 0.702 >> endobj 25 0 obj << /Type /ExtGState /ca 0.2 >> endobj 26 0 obj << /Type /ExtGState /ca 0.7216 >> endobj 27 0 obj << /Type /ExtGState /ca 0.851 >> endobj 28 0 obj << /Type /ExtGState /ca 0.8 >> endobj 29 0 obj << /Type /ExtGState /ca 1 >> endobj 38 0 obj << /Length 39 0 R /N 3 /Alternate /DeviceRGB /Filter /FlateDecode >> stream xU[U9 -Ct)Kݥ[kAd$L }*⋫IA-zRPVw"(>xA(E;d&Yje|oB%6sɨc:!Q,V=~B+[?O0W'lWo,rK%V%DjݴOM$65GŠ9 ,Bxx|/vPOTE"kJC{Gy77PہuȪu R,^Q 9G5L߮cD|x7pdYiSශX]SzI;߮oHR4;Y =rJEO^9՜gT%& r=)%[X3".b8zᇅJ>qn^\;O*fJbﵺ(r FNԎXɂHg ˍyO+-bUɠMR(GIZ'ir0w]̈́Ϣ*xšu]Be]w*BQ*؊S㧝ˍaa,Ϧ ))4;`g>w{|n Jˈjm*`Y,6<M=Ұ*&:z^=Xźp}(oZjeqRN֧z]U%tACͼ^Nm{Х%cycE[:3W? .-}*}%>."].J_KJK_͐{$2s%խטX9*oQyU)<%]lw͛or(usXY\O8͋7Xib : mשKoi1]D0 N }` **6?!'OZb+{'>}\IRu1Y-n6yqwS#smW<~h_x}qD+7w{BmͶ?#J{8(_?Z7xhV[|U endstream endobj 39 0 obj 1079 endobj 7 0 obj [ /ICCBased 38 0 R ] endobj 40 0 obj << /Length 41 0 R /N 3 /Alternate /DeviceRGB /Filter /FlateDecode >> stream xwTSϽ7" %z ;HQIP&vDF)VdTG"cE b PQDE݌k 5ޚYg}׺PtX4X\XffGD=HƳ.d,P&s"7C$ E6<~&S2)212 "įl+ɘ&Y4Pޚ%ᣌ\%g|eTI(L0_&l2E9r9hxgIbטifSb1+MxL 0oE%YmhYh~S=zU&ϞAYl/$ZUm@O ޜl^ ' lsk.+7oʿ9V;?#I3eE妧KD d9i,UQ h A1vjpԁzN6p\W p G@ K0ށiABZyCAP8C@&*CP=#t] 4}a ٰ;GDxJ>,_“@FXDBX$!k"EHqaYbVabJ0՘cVL6f3bձX'?v 6-V``[a;p~\2n5׌ &x*sb|! ߏƿ' Zk! $l$T4QOt"y\b)AI&NI$R$)TIj"]&=&!:dGrY@^O$ _%?P(&OJEBN9J@y@yCR nXZOD}J}/G3ɭk{%Oחw_.'_!JQ@SVF=IEbbbb5Q%O@%!BӥyҸM:e0G7ӓ e%e[(R0`3R46i^)*n*|"fLUo՝mO0j&jajj.ϧwϝ_4갺zj=U45nɚ4ǴhZ ZZ^0Tf%9->ݫ=cXgN].[7A\SwBOK/X/_Q>QG[ `Aaac#*Z;8cq>[&IIMST`ϴ kh&45ǢYYF֠9<|y+ =X_,,S-,Y)YXmĚk]c}džjcΦ浭-v};]N"&1=xtv(}'{'IߝY) Σ -rqr.d._xpUەZM׍vm=+KGǔ ^WWbj>:>>>v}/avO8 FV> 2 u/_$\BCv< 5 ]s.,4&yUx~xw-bEDCĻHGKwFGEGME{EEKX,YFZ ={$vrK .3\rϮ_Yq*©L_wד+]eD]cIIIOAu_䩔)3ѩiB%a+]3='/40CiU@ёL(sYfLH$%Y jgGeQn~5f5wugv5k֮\۹Nw]m mHFˍenQQ`hBBQ-[lllfjۗ"^bO%ܒY}WwvwXbY^Ю]WVa[q`id2JjGէ{׿m>PkAma꺿g_DHGGu;776ƱqoC{P38!9 ҝˁ^r۽Ug9];}}_~imp㭎}]/}.{^=}^?z8hc' O*?f`ϳgC/Oϩ+FFGGόzˌㅿ)ѫ~wgbk?Jި9mdwi獵ޫ?cǑOO?w| x&mf endstream endobj 41 0 obj 2612 endobj 8 0 obj [ /ICCBased 40 0 R ] endobj 43 0 obj << /Length 44 0 R /Filter /FlateDecode >> stream xYI5)&e4,P`vWy8+R+2\J|Px,ŹO2+ҫ>T()"Žۃw$|JKb$~5;:#&~Ƌ!IťP2:auuy3TStJ;;?&;g݆lVh"됳rF6:DH>)LpOR\ U+Zd21`P"h*k t1X;XorQXlP^ 0 RD2^GXV"*_TNǎ~WM52E4!Z f2Mul?̒kd]<*^'٪s;6Q7mkhi4g!,Ե?ݥ`S8UɚT)f ,Fa`I*",f%?v\Teqё;z7ǨLYd̑F ~F]F%2tH9lp;Xa\ܖHv)Rɐuu>+=: HlJm.5jD2Q6SzZ*6d!?'㍰skNlJ<?R=+2E{~*hi "<rZKvIQlO7K-u|ѷTOH· ID[B,#̌gY„7[cnHOs%ӥ7U*Q\gYp wª =]&QP/1>:#V鬼o[ܚ"%T)I6ehtiWLCKT %j~zj,TD J:^ D,SaS:6 S0 cA)@ ~2>ogaD}Dy|Oٰ7 hh3f)q sB?%#hQae8ԗ5dݮ.:9 EN086]S{ /0Rtţ\$DW2\$Z%yB)?=|l!LL+ͬ)r|d5}pze0+V5W{~|).W"I?_u_6IwF>JRK2pDyw\쇧n+TW"|\d 8p5g:OÝ45qM/jS'EGUķ_>,-PxkcT#S_ n>$6 n7p6G #kγiί*x{s!Y$^ #sf1g<ï^Z|Ɖы?bjUmG:4zXwaW. vF/ձ/ endstream endobj 44 0 obj 1929 endobj 42 0 obj << /Type /Page /Parent 3 0 R /Resources 45 0 R /Contents 43 0 R /MediaBox [0 0 842 595] >> endobj 45 0 obj << /ProcSet [ /PDF /Text ] /ColorSpace << /Cs1 7 0 R /Cs2 8 0 R >> /ExtGState << /Gs5 22 0 R /Gs1 23 0 R /Gs4 24 0 R /Gs2 25 0 R /Gs3 26 0 R /Gs7 27 0 R /Gs6 28 0 R /Gs8 29 0 R >> /Font << /TT1 9 0 R /TT4 46 0 R >> >> endobj 48 0 obj << /Length 49 0 R /Filter /FlateDecode >> stream xˎ\JjޛX6r^Y891cǒ?y|&<͌ k ̙:bbdb~2/⾖b)Hb̻7ky5?oT\M*!Rwӣ3fvX|L]O_ƶn{ fũ(eLQm[neHv.Ml{c-nLRxRm/?-Ո)XQ6yM>l}>%V3#{;芘_5h7Ĵ6njg:$BjRI)[y}wm[ȉEեɘâӔiV^ϙ\ֱS\S|be(dHc|(5`֑ċoS}$%FX8GH1FV>o>\Ѕ>=axSț욽&\]YkZ\Z"yKY]$&٥>5S7GȋydiVeͻs'];,ZI,b.YX=] {ǒ+,3u]Rpa2sE[/_#FN6;fgD2|q6eҟ@W'ĵӁ I~'gܛ77r|kn`}ڴOz.8OMr9cȢC~?|y8y-c)$]tynS e4nق_ghӫfnc1MkqB=@Pv#`LhQg@<5kxS<%XS֍̨fIe~W2&P&0Ay+RVv PL!IvGf=Va̕ yK`Wq} gwקJq-̺ è& *&giNPcwxQ^p1M ָ%쀵IW rxV8pl7Ua_sn0.!8f# :UPDLV8#٧SLwpZIӹwO5!!S!i-vŲ6$ف8"yY Sb6E/b,3־Gi1(w3j r'BQ;bsZҖDr'!{ B@0RpuwOU+y)X¹USIV n8n8b.8PFدfGeɥ`ǧ-=xviϝ2g= W QYAN6[GOi #HओQ+{ҫ&cmPM` ˦nagZeI2$NrV8q(˽Ϭp|@NQyI)=r^x4^#6k@x'kt5^ts@94udC#dWۘ;id; *O%`=va:T( z(@PQKCBm: C$[ݝGIу&H#4:К\lWϱwR(T(YMd S<$x{ ܆%c>yvtDTAkajT WEyV6dlDc(OT?Xi tk ߟ4!>=S8I8jЖ"h4FgB ={%|p|HI6[nԧ"V涥q83"R+.T[MHcJ:GII(+:U4Ì]T&WeJzǖ-JIU.OI`C%s*څ3ɺԷp;z'fwqz4tE9yrm"us"}`BӜN(R2a{/of8' Iݳ[)fYi# DO&IyJ"g>ثvP[Dk;Dztں<\?Y8I΅t4<20#1I։L]tgTJ n<9Ɏfa#-T&TYm#kSsM Ik[s6.iDeDE4X x8'NGY .$&Mހ;DG':54JahY$OgL$J4Zt kgq;2&ÿjDAJ/eWkK)˹/~o.vA{|u&v1QIr5OoF[6("PW)}Ic$LB Fj(H[ĕ&"qM?J|9`adݗ G?raёF&͗8baA[ƸEaMCƳCvr46C%aс5`f+rѷ=:v* k9>TFXTYq ⇬&QZH"NDƯa#]utk|z%I#,4 .t\>MIҟd-,gd#ax"y"C)qi "2'ZJ\ӌ6dH* q?ɤ$&[>3dżJ KPk`C+k=>} 8 (5@l*anդM(|yU`״rp2ւB;ssKH~ J 0/YZ{n8+ԍ3;[.y% ŹFq;_>|Rٮhc WK1Z.fjvss\Hgs\eIB*OoACĻ8*ՠ IJ$Q\XGqY?4uɘdhCa]& Z)N mE%XޭR;72X5R(Bn=!ͧlnaL:aR>r 5ɡSC= ~4uNcm "2?^%u Fu>4uWA`61L,D02+y> {"i>r zFro=:`}ׁ9g+Yi4h@d5N:ɛlƥ޽}[$oLc|`$Qo$WPhoR7meXOSKj9s+К.jw)L7#]ӞPg70XD nOjf~ uv}B0mÁѷqJjsChdE?\" endstream endobj 49 0 obj 3640 endobj 47 0 obj << /Type /Page /Parent 3 0 R /Resources 50 0 R /Contents 48 0 R /MediaBox [0 0 842 595] >> endobj 50 0 obj << /ProcSet [ /PDF /Text /ImageB /ImageC /ImageI ] /ColorSpace << /Cs1 7 0 R /Cs2 8 0 R >> /ExtGState << /Gs5 22 0 R /Gs1 23 0 R /Gs4 24 0 R /Gs2 25 0 R /Gs3 26 0 R /Gs7 27 0 R /Gs6 28 0 R /Gs8 29 0 R >> /Font << /TT1 9 0 R /TT2 20 0 R >> /XObject << /Im14 67 0 R /Im17 73 0 R /Im19 77 0 R /Im9 57 0 R /Im8 55 0 R /Im7 53 0 R /Im18 75 0 R /Im12 63 0 R /Im13 65 0 R /Im16 71 0 R /Im15 69 0 R /Im11 61 0 R /Im10 59 0 R /Im6 51 0 R >> >> endobj 67 0 obj << /Length 68 0 R /Type /XObject /Subtype /Image /Width 180 /Height 90 /Interpolate true /ColorSpace 8 0 R /Intent /Perceptual /BitsPerComponent 8 /Filter /DCTDecode >> stream JFIFHHC     C   Z" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?S((LFMEw]C^ڜ+h}q$ i]M^9|%M[ٴ-#F9?^ko~8I1d4 {s_->HEGYX>/7Cy}=0A4`.͞4 wzGi ՓBivFtKmVvL c;*q} *e8iE|3gK2ɩKOT>xC^|4˷SƐt_- jjs^ۇHѥ-|+S$9aX^I0UCZ$U \zf?j7i>dkKr& 64qҜ!E -jNr}ܙڳ3j7~$Ũ=6H5HԆ+³i(vu~m'~;| j~(3:xO9m#r0kxԽw2H;QۭvVt2&G$ΓgpnS OA) qxN%/y;Ox@ǫxwVլͷ|?us_|D7\5[I .cK`:kѾ:u ?_U[>Ld$CQ^lf\\^HNOUt)"C ( ( ( ( 5NIӎmo -C$I">냓㟴O|[k>8ǁCkVWMq$nk R@o_Ŷǎ4_h~ķZtWz%7:İ%Ô@S]|i/ѼUo^W|4,7d,V)Pr +&8{R[y"y9'pfp\嫴?GixnmeÚe,%2d88O~^"4uKشX⽺&e+?#`R&9 &9A߉|3,}NhKEh-vy҉Bk媳gvĺ6_ Km/pWUY{S}{ H\?쁪[EZNc[yỚK3pL]܂:SĽ;>O|&#otFeI#q"uRi-ZwW?,仗wCuo%3 r+Lx[O&#CՄumYlGfAV#@hs\mkQ.F?猀tvZ=~k/IR([lϏ{DvV=ZB?uǺ =vG*JeOf _,%O=鯟Rߊ> ҼK7%[mBo߱Y[} e'/{s\y`2xbn1pѩ%ilfEWzEPEPEP_T|7*ވöJfn&+m7d(4i.c?4f.?)>f6Ǟ|h) @[i;lDqfx89E~4=TF݈m /l|7>x*Oh|S-`8J Hxcx_g|r oohA<{xa۸\OaA]N <z!)(嶹dPpd9?O*A=uH4 5a4IVaGz.k ?lO,[khMEN첿B\px~?v9kڦ6udSϔ:3#| G_ |r3{_:n߆#PA? ey0x`P?kr~4ۘ3F0`IM _za kY~OektHg6yEp??a~#m ~f oo$)p]>=e6Zc[Zt8hBDwqx[4nu [O1v!Q}X@N|GSߏ)^[k"`ҭAk(s&Qguz-jZj$bm,] ہ$ N{Gҭl%д=BW:6=EvPBQ}m_K8β.t?"ZVW;*-|{>Xk:Mw6ot}{e֚.@E?|[ofҵx+Sú쉥mkdk#K3`4+;>OG8xSl-[E_{v^hmYȪܨ2]Qådl-Q@Q@Q@TtMoMืC$*tP?> iZ]\\X1' |xX YtصI,El.F.1[:^6^0AiHqE6Bq^Cuğg○ T:E[M[&63O(&mwj2?M[FԬ,{ o92^]+w?|gT]{Oֱcù[A^qnX|E-ͅX׭52ZˆU!>I9w?xc/0xJhGn%Rmm,d~,$u~0m5 OŢzĚ=/|KʸI.9ZJfQ0^ " 4~Wo7?sn!FP^&bx x㦟w|;]jY[{_ǦX\̷2HGf-)+gizv5cMDWZL[XI(!xz7m?^v-{,zJ/VUyEp@VIY=ψ5(,ki.)[5kLm2.Un"d-¨2 x[OljzLPx&ndRMvUMXwz½>Uֱqkm-..m +v9Ge_Ԩ57vx綶[--U`8)rP7AM>UֵTɤǪK5y's fx s$ɟ@Wi|$\_Ş$$6ږ4CΞdyH^ ,yf#N PEQEQEQE_&ě%\%3ܸX,D HUJLPηo]GHum2OYg-mm2f.#LIu|eνuľxvAխ"kx\"]nIT^GW&Mrh\]h^HݗZv`| HLwW:^#,FeO5~߳Jam7|9o|bhH{|޵:~ƴUHv{ejTuIӟxU>3п6~ SO?Hk(y_[p??6ռ(:ꄎMs@%ks?A7Mz؈OpXO Ϛ(}dZkW')>_> stream xU;ZMlmT661mLjLicb6R*G缾Q/y+" SADP@!9,XfoNN^k͚5;{krJi85gƅcO=yJ)|uhU'Ps gnxdSa|u;׹`} ׼.z[=@?9}tw}!P֦μgK&4{WM.pG]{=(NkT%9x@ j2sdCs/kO O>_{⍼z*_.>LˆEѣ]  $4E꾣E>/뮾o}”$|#q=J* zR=6W&l4cb{>t(.YlkPDG[?)B7 }Ltvz7={ep(!F9[#΄+S(̟OƜYpzn`i^1yz$śz-d\)];QQ-#aSDUUnE#gVl$N92\T OE9Rh%j _D|ۄ *҇ Ң9vO86:Ilg,=e v"RGQנW<ʴtMGD=8(-ـ_ՖʌC.nHҸ:>^E ,6BnkM.ZDDS/52y%lwܹcxX+^W7w56zdKRy0eݻw S$崗h]BDZBe` 28CyE|16ӗ2Hf*:#5@DIx$Gf?g)A} 7P ri#ֈ[}lU&ߎ;Xy@Hy B׷uVN 5/sE ,3k'%f8o۶%jyGXP,ڴGwukNw.Yw;\^!˒NGcCVek.vB#ru]lv:gw'|c‚Y{}*5LE ,P=pzW9a 3qSI6%94M>Ȼ6xyd3+6ھ}X`nnSj5ny:,%?νlȸ3~3/ǃ)pq̩wi,ymuuvi JZU@)S ,oZ[KF=>ܓz l`iE3̿HƱ>/@I﮼45jZsi"WvEI /}EK|E Rf}W/nbߤ^gఊ=sN<- 2fķ  p'IT[nMRZBoQطu,DI(< !gE""5Hm*8jn?adT(_5fM,_ݒhYƱ..؉4ṳc  tPVQʙյNpu6/|) sD =0CVjLgy)4 ׌HQ?wEev9֟R+0d :y֠X;n|HhiG.D&rܽݝWY2%)Ɖ ,grL+#me j%ڎ@8‡G)Oj1אjͼ %9WEHk ަFh;k\ MD<$-?/o> rqf+L-{D Sx-pqz w@֭Bn8 |] r"Z0sli]$tөt(mmD#ƶ\_|!K@)^pH+2&[fɱIΝ;]КoرH*>ksR-[:X2pLCcœVG HeM G2j;S"'iϮbJ VsהrHbߊEA Y{G6J^|ɭԝh[slҚ"*@_9طv$ 6kP6Y8/lEIe'dR٢rlj; ?oD@@hEPd&#"l#&bmGHWѣ5[uNE(0^($,xo §_H i/(Rc9E65*-nI,k(Z)"gF- )2D'[8Ǹ}ϙ(4{xm˲5YsFVw> 㑌lT?!¹`;bs8-cshGZQaj&qc3 it,_3"I{!fԑ"pb[fЫIM ڴLV6[C_Eq|͗eRfn-:Vy(Mܶ!26V0.TRYe@䚵Fjr`9x|2@=1zhR1-O܁ Ð)C6RuT%\>3kz`TnlR^Wۛ!U~{yE`Fl/ո#d_Dс3J-myhW0_?|3ѥF SV$ktv4Pk聮+I7W}`Bz@.ig@囸a%&) GA5W0m/a&ξrcq͠Ze:h|ޛrg^(#:&J@0FT0q/لu'&l㩹Z&,&f^ƺM;pݸ5#;I$2Y镰G^a%Cgp. 6ԖOj́G4IjI!kH@y%'46>l9׷ ]]p\{moL@h>(*!meWn 0Ǩm߂ `9+znmMuR+Zĵ"\eּ:QA0נ,3` Rb-,,Umw黂bF0xQ!x%KrNĖA@n+x-SW-+Yɼ<'MB`𨝤1]jF)FR4'8TCY2; w92E ] NP<}n,@ޯ{f|DARk/s瑰gXzpVz:nHfK*@%s?3cf d%s`$OB`0 G`S nIh%dE<= #6Yiۨϲsp5ト \l[=D,zmT9t' iZǜ%F^NB`06IYk[Nd!:K@F}`C\{d(KLeD0ru7mV]@vvQL)?L[YjElz?*5t+HْM^l,{m(- /I`iwDYˏYZry7M~zZOUBM@þ4]:\h7F| u0)sAg3R$Sm8:NfOW!Xs9_#P]_,=/e1y-<Gu!Ѻ@W#0j%ܠN.Ҕ}6Д]c^vSOo{4N؏y!NL[8bӵ'Ͱ\;#}>D Hco)HVx$^"PJ"U#6,zN@ԩ3˱|%*h]IB Z,lFD 1 ޹xPC@{ Xx wCFC@~IJ,(ƥD.?dIV\M3IXHa5ƭ@ ѹ$w<"W1IKfEZT+ҠA"W%aVQs~4M5n 냶 p$i d2 'heT;qٿT6 hK/ьdTK&mVzespM#0bSklvWkN" bj syԽ`,t0g)g O~Xz4mWf*tp8 .Hu7 W$MW I*@~4:]r4 N= H[Ք!VB ׍]|ʝJ>`r1c 8$cE]fD^&0s0.ʇ^e?z("3v:j1Wis6@Dڋ1ek5Zˆ!uyz pq}]V'-x 2lj@ZLZ,ƯմS^1X_ki=P#0jb<лA)&jj=P{@j4; endstream endobj 74 0 obj 5248 endobj 77 0 obj << /Length 78 0 R /Type /XObject /Subtype /Image /Width 165 /Height 120 /Interpolate true /ColorSpace 8 0 R /Intent /Perceptual /SMask 81 0 R /BitsPerComponent 8 /Filter /FlateDecode >> stream x w tO%}?ϡå )$N=>=XF?_Ǐw7w<`{{YOׯ__V:_b~\<}Cy{/ᅧxB=nonᰠ? J]fz՚x6kR,J\)7|y=a9EJ'*)\b5 Vozl/>6%bxdj^ϖ9tA޻кYOʒ2FMLy_[5\@]Ѩf1򴾀 ˔TK|?(TSQlZ,1ίxz:8Wx{%JҦ,9!Xh0h!{VoD!/fL좁Mqa~y}z>;]f?S}e~oon_K۟?D[/K̟?~qt Ȅ.' i'3ۑ-],܇y_)[f<3Êg:i_NpT8iGjoV"Ybpk}?[wbG'i}qT]\~,^,O'c#Ɵz~ˆb%ԯhg~>a1fcEڕ--q0n>YLzM+%MM :[# &OO`d-[`//9|}eܶb׫bU-S,¢} `-\`:2eSd"ǤntZ"NuRsdzʪvs*6AALRVjZ<ݡ z5plθv3a}<O 4Ӫ{<f :W 03KS?W5ElU|\-@HO&QzXz1tmrI YjkdHn JĪD0EݔBGVW,A@ݫy5(5p a>95^9|:5{i\Zo+hV݌:Jì,6*Ɏ_^Hgpu:ӐlAOGqL vkwYs8NJ tdy?ufsQ70b>:yC;1)gVˮEࢩ@ϫ Ƴnc[v #+v-ϪRCBzpJ;Ud1Ƞ-y(tX! &6 gHg( T'#T|鍷zpCe~vekq0e?VǼZd xwWʨUn/_-n"Qı * h}ՁHʒʗ/E/֢㨏% 2Ut:u"|TYSn(0Mv_@iAW[yu4-+ͻݾx:!a;K/\G!eYTaX,h`U7)cx'ц J6$8Lג]j K]ȹB?Jt|̡b_ɲtZu&nAb2!~,rtp֊~첦PD2RlU#`M 5[#8 <몡d~ltLn{2J[ԍ:|v%z_K7}Nn;թ8ʭ[ꇑSB`}z.$Z_'rɏN)- 6?)--EN !(mi JxٙH55g$w+mc2@,U8I:YIEؔ1it#II9dW8Ē_O7ml~n=m/-VAX4> 6 P(HJɦ,̶AVϫnCΌt `2)=+ɳ8cճx䡿]k`qu:N qW߅e:d3"YhT7UN aٯn}$[3D hs^ '6"{U5D;TcLy׫OaGUounXW|a;-+ O IuH%!t|>.Wӷ0RXK_ʰ C-jGPAz2Bkʾ syEy\#7o!N hScIo4-fvi-'`STdfꆙƍ+ pf9?iٺՊXkEy%yy>e0͘P+ #6;gGu[lk9luxCr̰SNjqDhW78! ۓe )%IJpu'QZn(ZmTZ3V0`\av06!9̝0p]\ԡJX.Cv&g7,Nӹ0Za)stXC R pMXSDnK#N2& ӍqQ3&B'YH`6$F~M[`(^m!z瘌C+Uq夗4Nn YMØ1Pێ XIuȵWMnӖG,Jar]xEJrv{_mEZdn!}43G7ꤺexX;8'ִSW":ɹ۪C-)nvo'`}Xr(qcX(/&3j E#7j#!<ǯ`y-D"e 7əFl-^6Ln2ɗgM`iOMIfa9ylCUp*9p5AhILJ,#EhvjIR~|AqP@U.$%;۶RGWZ>mÑ&_JCH\^$Or0z$Y Ћ]Ń;)%֨n$A #ӄ< JDƺ0_`2nKiFin5 )(GRInU̒Е\ Q4>a|v<5sC0du$+ n#cdJr7sKfO&P% DsmN@aG1s:~y&fXWo{ڒb-: Ϥ87ZN0O-?ȳ0,Kgջ쇼2&6t65w%y˕}s0DM#Ã&t8KaSĮ+ڽ2D3: S rYOj~ iZ(8ڠ{:\ Af鰭r$*=-5f ,$rLL 9xZ[펽К)P7#?g萉<)"{\ws-+|MSANY{o )c`+kןOg۠5ccA8dvԗ[NlJ^S8%\K,p?I6V$ħG6v fȫ)0-\ޝ]̒uyy8"%}Gk+ u^Ϫ3WC5n(cJE|I©Y5A,G*NI88-O20kjsx$4HR2t55+Ssi ,:ԽC)i @k MGwp@Y(c;zkMuwhrsbXQnZsE3XbT` DXMX+/ғeKf.,'Dx2a{U7 $qjeF!o|t{Q?bN G`d N Yl*䦑1i!۲f`. ym6K8Wx$-Hv>|f8pQ&mdd'$KtEZ_^$#,hb_#S; aUr sCIЁ-+fO6Pw!V 8rk2Y|4`yf4s!iug[ivJu>6nFǹOj f%PeIbDւ p+8QȕT0g(+!*;I$b&H WM$Gd;BbsJ̰>ͱ+1̸s#N"?K.8^"[*{՞n,9J-'2gA3)\Y.] VxZ5rkwc$/2}uyBPe. nU8S :DFcUWn~KЎ,Qhpo*V fD.}]ȇ$xawv i&XoŤ'd`sRysr.0@),osK6w W;"㔾wȸNWHelgэ<2KH𺲘)a8+j^rU'sѩW鶥|JÏhF W_>:}QFC8lx5?A?t*% %YI`+tvٕ,"K.Zڍ5Ս`3Ĝ)mYy~QgI9Ԓ&q?|!t}YsYn΋r hXj(0Y G;*KS~ĕ3Wn,*o0U%!ڗZM6I-wMSܾ-8n; $ e,?Ya m yr1lc5YI7K\ -u=yd=ro+??3ZF3Qţ. `Ryk+Պ 275,V.J:z ?gߊO ]mb1b#K,vk~}LQi "e;6d<4p+=Y9٠纹sO Z:Mکeԑ_Nkä_pIX [=Nr'l`͛Ǥ~BqZR #8r6"'Mu'M.Y.dXYҜ|QQTe\vS-g5eCd'|K^ rr|bIJ[FնǙOn`(g8ӿ=gd K(e;WVCDSn3DJH ,šG^MhrvL- '`4FeqM?O@Ѿ$@ьec$Qү |شʻ8beAl* eۮd\ Z:ZeE؊__SZ٫ԍ ,E&PYBmPHS'_= WZ=dyem`ʵ,ʕX(HFP3:U= q)TT 7ֳXearcWkWBkD{"U9Y"ư-qMc1J..Ǧ1N _b?n:Ndf

$¡1U;^lƊU ߋWB! Q>]+%`TSN)X7QݒkDC\ ف^hvĵ0gmmEqj1/pBsƛ7x;oW֩X_=P 4ev1N*7 taYO FU ]*+=rGvdd [6KnJyqKUQmP1ɀLgZn 14q)Mh[dkQ]hڕ驱#"]RK٘ {/zMK|ܾF,L΃|3Ԕs4l=_]Ha.!Xbt]Gpo^I!H} xqWRE, :(% fṘeJ)DQMrn)ል(hbz1icܨy¼ &Y #S`DIRAٜ+Yzt " endstream endobj 78 0 obj 7078 endobj 57 0 obj << /Length 58 0 R /Type /XObject /Subtype /Image /Width 55 /Height 55 /Interpolate true /ColorSpace 7 0 R /SMask 83 0 R /BitsPerComponent 8 /Filter /FlateDecode >> stream x1 Om@a 0` 0` 0` 0`10#s endstream endobj 58 0 obj 63 endobj 55 0 obj << /Length 56 0 R /Type /XObject /Subtype /Image /Width 56 /Height 55 /Interpolate true /ColorSpace 7 0 R /SMask 85 0 R /BitsPerComponent 8 /Filter /FlateDecode >> stream x  Om( 0` 0` 0` 0` x$ endstream endobj 56 0 obj 63 endobj 53 0 obj << /Length 54 0 R /Type /XObject /Subtype /Image /Width 55 /Height 55 /Interpolate true /ColorSpace 7 0 R /SMask 87 0 R /BitsPerComponent 8 /Filter /FlateDecode >> stream x1 Om@a 0` 0` 0` 0`10#s endstream endobj 54 0 obj 63 endobj 75 0 obj << /Length 76 0 R /Type /XObject /Subtype /Image /Width 136 /Height 115 /Interpolate true /ColorSpace 8 0 R /Intent /Perceptual /BitsPerComponent 8 /Filter /DCTDecode >> stream JFIFC     C  s" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?((((((((((((+'~-ۭ)YMZWnMRIj4a4eK$s@)BG<5q+I/gOd|q-yxtKh6qM"۬v$p+ v~;/TϏ֬׵RƒHRya9ac2G'% Mg5ٳIYA^5OxP-iZBt0w%VwO| ]Rxᵭo,OkvֺҬR,..Ō)((((((no+ڿkτ~"tx.Z/I[Xqo#\Mѣ~`uёdȢFfo UQO^~Pj?':tOP|dگ;;gG*\ɺ7Y>F |Bt/|EǺ6+6=cA~;|Irx⏏^4'Z,/z=_n?~-5]fCZz~=ߕ 0Ge;5PQ@Q@Q@Q@Q@Q@Xo|dRkxFĺ~]i$חaS"Bv`s?`?wÝ)*M-n$n-X5/-$C%JN^H'(dh [ bO?52F%޷tH>T LJƬH`/((7x7<=k_/m_^JaOvF,Ir_n|? ۫7|w[j6 \ȡKq2o((((g Ok/&a'gq<9ø=i?ᚿ2 w][>_ݏnݸg~6d;6c+# oI]@1MGM"B!e˙~id_>" &[-;UyR8|B%H/.ByGo[qI Ki O0~؃'?bKjjr~̀f #UNk/?Hw4Ԛ}bMCÞ9P˦@$Iv5?7' CAf _I{kGNIdG#Ϛsen׋O8V*oH9K6]KY_p:\cJvNQvJJMgUrLUW!CT7~ϲ>^ϲlsO?`'>qmhyUտ?iݻq`"/X> #\h)| ERX&oq$ӆuxmO2nk|~mBJ?n._) hiO6֕5ڜ7Qt+[=naiuN%UZ4U>u8i(꛺<[': w?Q?%4L^˺G #<S<o,S>#~z׍DZObKy5<-v|=# SNU_&~g> |)o8I~&h^4My`ֵKg;GO!UmɆl<ZcC *яOXrFjZKJ?"+?`߱|t]tFlj~.K_M۶O%OO&o'gU&w?co3ڿ۳=\N?Go~$4ē+R1D[)d`ʜ!`FIF|CfJSP> _M Zm_}#Wkb.,|[&'?Ae][DQZE$>wڕMHM3mdvT+޳E ߌ8?tmN^]BcgG.җ`FKSAE|^xRs]Aq hf1lwF,ۊ/LRTER| u\}*CGbq2.z5'YjfNonϔa"~֚Go>![\}6&=PGn.> B2h q v}swKy4*G(9 e{M /2[b|/kt ~n~PRFd`2] (YhMets,2Ziɦ3դo]ZRMꔚٳgm7_8am-ot?j\ M{)gVkxN$f0F(+7~}m)kY5kYQU.$,ܴgg,X>i+7evVo[],4!AV$q3Zm{&MkvVgGš'–e]>6y;ѿ]*g&b71<ַ(#Fe'kh]e3ړRmRWvf\ϻ8]'tiQ\xi5G-u5\J]}k6TEwTQJ 4Tc1RTۙo+S((((((((( endstream endobj 76 0 obj 6333 endobj 63 0 obj << /Length 64 0 R /Type /XObject /Subtype /Image /Width 164 /Height 162 /Interpolate true /ColorSpace 89 0 R /Intent /Perceptual /SMask 90 0 R /BitsPerComponent 8 /Filter /FlateDecode >> stream xgti.o{wTU8y%2 B+ ={o$B8! dJ} ']55=]43&FG) ~ r?Q_p;6< /)0÷\nƲVSpynB} ݌5bh3):J'b0a;$m'zGՓ A"UI[1ntz҆CB)A4[tr%"O$Iv'nR&WVKTQ6;0jsyVQgg8vOvO XL$E[@x&n>c T& ,vGvb^RA" KTb\\ffIƍā$C|$ǥ$X52vGX^  F\fl bYjFFޠHMf\Nky ]NXcJ$pclp[УÉBt ]ޠ ]Qu/[\̗Q_EGNJLNC[2Wpd7Pʔ)qq*JuYۛHIf;` ZۧdgEDGFF8 AP6h4V;i!3Q0nhx~zcW\E34a# "J I;3 ZH` OpUbd%'h Q'AHIIa:#mscJ|i ۈȼ܈o4,<|I[.8 :6$c4nLӴe1aj X;A ?x?=N_Kj?cd 6X(04Ƕ{BTTDr€LKyB 9 UI3cq1qD ivȌ4 b&N'>)aW_c}_k qqBdlbcƏK >?AK+vxt`CyFԾS-ec8oOi0>8)-5>%99=tZNO5;}ZP8u8ACVop Ϟk$@s@\i8<kbxXJVfD\ld\̸68+X"#M W@d@I1L>U%&sL>1!:>Rlfqތ i __ z}^/,_1B{qvHZG!;?b&ӓ*wS@פ Ŭ*l.Pb;ﳦNL8>01~ ƚ}Ǩ/S V0q)BnUF 97&o`4cjIi1#"=n&45fssePi~i2 =z"n?@kw|kT A0dOӛp a/wZ6^ã:!fL Px]+pݸ1AAGf a ]GOsK\Zop!u;L ۣB_lT􄰰4Cʖ1~8{._|؄&MğH,6$D ,V,Z`6F:CD=` Oe:-uq+:? DɉB$1VIX._BRBxDxXxX~~nTLk(V֙(8 (/ h1V ˚C- Djx_.;L<.Xx pXzҪ2Zx"LgOF%HoҒjj_:A""5D9(1'$%G@qG0.LmX*buLFס53! >c Ъ)8)x0pДBIOI7쌌4*3ԘiYިXRCP,Yaa(OiA_FHӔO‘dž.ӟ>{5bIO8 * N_0 !J pZ#e2P̴t<6@|Q!q 댊JNHЛvhmfկB׸}> gc=D B{}m-8 D:x,uoİ"z%BIHL< ~*/KX0n.)LaVfLhLZ*kXgF:84xϞն=zϜtK\'ϞսxQS]&z#XkͬXdh &tfqq?4&$%5 EFB ǏϚ+-j>o6_ k =n}~ހie*B:#5.λ9#"*ji+{p YH$ rj%);=J4,e yaUYHZ`HJvV ,X]bۏ93Z`M On^nZV\ ŲVxPBcYhPi  b .ƥ޹u <\` U1_t ޑys?sZzƤɓZ?:6.)5Mfq@akǒU|5-A &N0i|xDXLLuy=Qg% 帥Fдӫ@ e wݵv e?=X)cWwqlLqx.@o_gz#x`^ > `6'vwmn|NF{֥޳w r!KX:P Hu$YaF,<иHG&$(LLt|„PFdxtfW?kIV1~ZhN51:7qrnq^0d#fV"s2dR Aݠ5yA}>^{AUu>X|zcosYF0o|!L>mt,ߵQc [`43kWlԓм/6t4s𡆷oaAP-ܰ!w{w7];xBsp;6 Vž5M+8{7˰\`bEI]T iq1QRNH:3[ ۫ᤔ jVAU F3XV™3c# rq.Ÿ5-g-9~urMdtz9uӧ}mv--\^TnWsr"jV|r0e>X P, 6WV4{E*LEhJ1S;njGwmq xc,jB67 leg8("”z=_U-=tpCP4 PVC QMhtXH}<Ha -1>1&ux4rqfRBVz3{@Hj;axZB,oi?@sDJL<]Iyܣ Ͽ4ܟ3:Sx9Or|.Ig |ݛ 59q۟>}s..΀MXC4`w;Wٺ$DEXLR4oeH!P@Ð?wЀ3񱣫K$ϙI./*˝FkIdJR)35a&QT`[ NcM<̈́79?( j<{GC ʹf }r'd-*{U۸+mO"]]m\8vNzeY ekU3ʊ$Ts7O=+~w|ga!m9;;:.ġ{:tF.E<( ڀF =#? ߽y?ǰ\Fl5qppHQ`K F'qP- CY;@P)蕚 gd?cPN9nP-7NˊIZA2qT6JhN᛫ޘ77H^(ʗg쉧IO tlp?\s0vf^bë]<#3bէ3uHk?qF_7EBG@LÕjs!+.~?=gW3Z3VRl% '"!|cG\45cw ~ӋU`b6KaGP8xc%&ZabbUPPJB*N8,)t.B.ɥ]b_Rqd_~ELd6`23"d"iOd k~@@&ṶKM{smȫ?'uGe%%v tlTՖ\ kSPWXFO} SzؾϞ<݉=''q+ Jkq"d Rr >biڻm}{$-=c0,\gOE<86 L!1X:w3ġ}l5z]؅|>eg_Tظ$`;fUwpbx AN?).65>N4h{cXduz=\"ͰqDBR3n8 NiЛE #8<[xSZw.b?[6 o??}w^xlrYYjmAB 0Zj)hںu:4 Y.ښ,~t'Ƴ M@8yH?c~/!lPԄrjWuTs: B@w/c]#9%1!2l岨ҕn/!#&?k ŭsrL<05MF賘 (0x(< RX}#&G׬w".n:WbKHɕM >M:ѽ::+0/tDYV_~v7#@w!ĎgJyhxYcZELF$EcΌyP q1nH3fEGᖠd#a┙ŰJ"r9¾saa[H :`PH7 @iJM8gʥ5+ _$D5"L'UB: b!pD52@p/@ʛ׬|WWwo7A Psnx_z H猴bDG8䵍u!3V F![`ms:#F*C<048Vچ%#fujYWvgϕ|5G3Lv͸j<%39`tc+i_OC96둿NX? =B \10 ;9;@9X-b(¾_L<燺nέ--P:,0ŀB}_v`L8^2-t0Xxd<8ŀZV/p`IMbV {yׯTba@${'FEDI6I1QZpk5jfV\ d(ȔبF€`J};"i F 7z}I5 7 ?_eӀҵ?|u]dPEGzb/q?Պ;>?>`fdJ6Q4\W{ 3ڊ3fES3-:sr?T:-n6lH3M"gj6,T"Ͳ50Kf2fu%P4:5#=9>V$8ƨRCѴLl5+wkjj@PFNX3Qqoor&R)6 :P։7(+W1HwK;&kO+ȣ;U<}{Lǹ9Y eJfq~zo'S,9d^~ܦaRl.4--$gcK z3ܯֳ]M\zUh|u@)RCÎ9Ecq#h4F&Tt<2;<7݋HK}lX|uŢS|fd?{xﳱ]Ȉ'S@`?T84J)CٲBMV82%R|S Ai4o%:K\62 v'tQN-{\"d$trprD 9Sɂ\"*=!=S?Pp76x0>̝_<1?}U=0i-e2-+2-,6.()Ynki/1 V6nFZ?R^+\|DPÐ PB@23?Pw}]SuiʃW^v 0fQbϔ! b6;vb!a'4 ߿Œ*iURa4̑.'ÿ†#m+5ڑA uEre*e~ԈIͽRƋ4>><7RUW`2ah́c-3E5'  sd+L%gyRMO so+kv=(O r,K7Ns^.ֶ2s̋K̋Js=8J= 3X;~?gGJaɠR 1@HT)TCCCKi\x%7Խ|SW .cg, 3Cd2)]|XcீL"؞?rpdh V3iYd:"^(l9*rٽ^!E×H##âcbQ*ƴH鹄i骘~g@é yitYnCeD{>\bpZyz>G-*M6?|fy׽yԬ\Ӵ\ {Kճ Eǹ"Rs>,+̕J^pIew>r{5:_<>p[+5F bieAw<a [F\oDu?kNZ²Q"Fuk7Q/h) ( #4!*9yqfqݲ|C^.ddKmX;_:*3M1Xa}_na]QZ>7ɟ o*m۞WP}綺zzUR5hTWq`>98 h hJp"30 HI sh8b넌,)^+WaW@ ~@T20+ c"3XsB/5)>b"IdR vk}>.YEt^O#Ɇ53,&ru;oBh,zIom:f(e6NT庴=^B.]c@Hwv{\i d|\LanOJW$իjbA @#`gl,JQFL %#ح_ QkZqJ3 ;vX_9϶)>JaU,*x"8Y '~k\ϗ^odJc)< f6N zJ_Bꗃ"M_XUt2?Yļvу+sgg:/"ֵW+/= rEEߖjusBX,˕/.WY۱fw|aS sfS^}q k,]|l'2*i Ž6YYά= =6ۜP;C5xd,.-sdnJ@!HkՃr,1$ lX;O^Dqx]OeHbS KfjT5tj~1nYS5ڪ9`[QՅ{wzshtel۶^|}G17г5ܹwCGgO&-4߂*aX!&U-6ېJ#hL>/:(zubdcgq\%xO Q$:Y/CgD|7M"J4ḏL|\1oPpoۃ z" oFւDq. |BxĈ(IHK{)u F$k` 0UXkpjj4tmEq_}%q6)nCOk @==_h͝,`YxzdVD䉹k+WLS/).-k}z8׶6T{Ԓ"2/*ع&ع|Z{7#/#GzUTt&o\vΡOIwtaxչ#= :gƼ)_aT2RP0p:7ƨeEZ~0  &PB7 'b<EF  zH< "8XV=R R!g }ԄԄ4@au2H/a]<57Mb@kih[Y*u*1!nZVEP θe:.7Uؿމe{V=zRuƚ{o,U?Y[=?WN.iʉiy\h,&I( Wn(T昗M!*ˌoVGO.HZ0dSLǺNHh޿m0$U޹_ PQ̅s[Zk@wo_>u]diåȈ  ؠ~imS jwVBFv. =P7MF!"Ah興NZR!ÒGA>Gc/X]NW\ Z=hZT8ݱ-}E(K~?12bbDR4UsQ }@VJ2`)t9KzَFF޽ϛieqpv%UEN̽Gwnc)Y>;|sEpƽTI שaY"gf*P/z6v/?{ iK&Z-˥HrԚ(vƍ?@~gϜ9ViJ#qA!#B!CtwZ@DoP/N SbQrȐ+ ]۝N yhFT*t*,P7 $0V4 `%1:ޏ&X5OC?R0y^ʏ|Ib(ΊX~5n^*sC>""AI&!Mf A|l=4ZDɇm/K~hxPwR}ɃRubpz/hn4׽}j-~(*&5sƑ+j:os[}$|PW,P MF7;?<k3 ~ JTcTk(K{=.KC2F.%A{qZ q_TCq I5ϟ>{^3(iF NO Q:8 F77+8ST #ά@&@Cӓc"q*ƽ_= 8#z=Acam]D&ZkuQFJ ǁ'` á  F؈9~ytTSװVj] iԯ[ك}{/]:?Hemĵ-3֔K}͒+^oXZUH]Cer+UT<|oj]=PZ.=+:cD6%#CgA!"^Tbl7( ## v ۋ6,e !'XkՉ0;<:vu߬:tp"ǏpLu[7}衣@<ԍ1L!+u .Ϗ1da5#t 1$|sdR)X1BcJEesH:tn`zl-7޿+K@}2 L\wpX1QR,dsuf.ϥcG2d uqnw()!!6a؟cKNj 91" \&: <6J ;oqlG!cfDύKdj䗎v xƙzaDwm[i1ū*xO~%0XjRr֙gx\ltQڴqʏ]-/ᣆ=M 0ޡʥZH qUޓZ*pHxlC0I!&е=pJQ:ǀf! `l`1`#)BƯ/ :Bڝ>rV"z ȼE2W{`MbɍӧLN69**vhW>4fZ*'S2^̩SR2PTh,V|.55/$"S42" ͛p!agKQͽUokoߩ}Z0yKG?$vcݭ5gb6-%%*ם`I\4_mhgAmmn~с;)/Ev"|7qQЦuեUרQwnt|hlYtTvL1;NܾmáP5!(VZRT4|ݖ;y!4_1UݸPX:#MKť#B[X7ҏ 16ӸǏD'G(U_K3wnߵo#1]!/I@P"C> KN |&a+:dևqLuVZ*'/+ RlP3'B8v#,ԡ4ƇmDGGĄO):*D"X2pڽk-0ۡ"ugpp޵kE#/vmm'|] vwno oԌ+ @&.BkdIS$hjX=Λ 3"$,*+yjcqpJjO~3juZRɹm݌Xp(/9{JĵjSǷ[vɱsBP~ k5L$<)B$pmڼl~Y'/BC#l1xטޒe'? ;5V>!a_]Ɂ̂A*Wr(U ` ~g(qy nH835J|j#C߻qcY m5QѽhsWr`8k^HxR4t|podE`kBb媏" ~&L!ninkl28@m_U;}֜ng0Yr!++*J}WWFq/ ϙ-q" DgCDE'FZn_BY{l޺Cx?%v@vƆdWKz--K9]G7oHHvrO|+Vfzl=煓UX$1 jBj¶AEdM#(h% jBXPw۠Rq@tjfc׬FV  bߢ"M89*v7p\Y7ݠcm'0;5YNH.}(5 g͙m6(gajEMbXX\B|fVƸ?~Ţ g_x{DT 35Oщ4΀^7/_@5ჀzuY/%]o?=&폍ѻ7z]v';Oo;̢h.5zrWׯtZq+xi ,BU15hy`4w?q bN{7ֿEXGAF ;}ѾO]< K8*M++0B|.xC<`E80I݆VܰFd,0chó#>}]hNIKհ1azx!qDE] m@ж?)[ϫ475'iGGj=)g!2<"@H|z ';%5[ n]_{ΞٙٞmLQ eKlIe,+ H9眊 *sΑwmƳsstn}snP\Tα|`?i;wt+ݫں[ڕ59)!c]r~yd^X}֍SU̜jaҒ[k?Ԙ޽cG[P]^:/|i16^+&+N}',nTIcȆo5}N6rOYeӳ/o (54 ~h 8Nm/U`e3nNHZmoSO>?/lFk2x#*i̜SآfU{Wi,-PݻufMI:M礸mX_fͰt)II\V֯Qt˥vvOɘ#ǏU5Ɵ㤅ue>EO.Mgr脠/^eگY Wuyꎞ>|q3XvFMM9 zL!<O&lض}۾} .5ijg lݺ}A_z+ۘ G sޟ(S[5Ua1hvU bzvWT!=n3g 1$xH@A560Y0#ctLCHtV?hk}HӦ~}{鄆fmG 'g,QSsf`2]9mrcGG@3N;I~[3/tKӲFB/>1˴'h(:>^7Sb8n[ke$=I2U޳8͂U"A&Lg;X]Y#-/+ЅsqE Dq+׷JPW%nma23: HTdN&s:h)lZwvtq:˰:Dt`s6Z{QPѤ9.*9 mn ,?eIqiWg>s+y>;)8a7꙱c3~`ѧ*=wd[K3i+ɡGj[;QUAyÈ۳mOMsfrցa Umzwiz2XZ)"ЇM X4]Kau_-Rʨj)4Q 繂8k8LX:*s KyQmOΛ?o/ZLu߈O+cykaXe45UKs1ʊU;\*EiwvT"ܹ7KHC"t͏t6gee_ce<I+.PZ|C 컔Pd|ذѣi/>|^>t"io M7nX_v[:{x ,B NǞIhuYZu٫\H$Μ67W˱V'Od=W:p? =տK;?~nIMs Kϫ+?d,!bbw@ٽgh ^JQ z¹2ouwלMES 4`er0XggiLd:-12@5sOg_nؼq٧ϝm}5yS<}׎{v<~߿`cN^]=oJ bn,k6XB( erm[EbOD G9I۵lܰl#^+)ϞxrLDRuѬYn ٧t#(@9+KK=)+ BWgNų>%bSSSstNuS1;wm̮׭]`ޖ:-6_\NI7{sWUj,w̙gL{?i]߰m͛+N|;vh)祽^3 4u׭۳gB qg'._>sF7l 2:{{u)j5yUvd?(yoL).~]8yPQMpC dm&AЫ i oٲzu='vUR݀z}} 0fԈ~ya ݑ<9;]p+}]0BYa%/=DUet?t÷XhVʪ0 WAq`핼$c5TS( 9jZvbavQ$Ə7uי%KVϣnX+qK5K{Z3|U|՗hJM|雯'?ȟމ9sԩL>2+S]TYhSa`㳦MsT\{mxT,$f=u@浫>d\UcKCjGaSӷ^1 JK[HT_e?S6JС zt+sWz{g6ToSc2֚HA4Bضv-E-_QZbƻ>._pﮤJ uvS.q\8Q{kW=y&$KIJv};S'k+eGp[x%K[?MdNs'NT-HmSfI9>EEw˟3eKw_O5333=!,"#-kx헿C5\-ĕwثF^~Ok_^?sv!sCI-yEcQiA@=jZʵ^$Ws#X+|+l3R0v!8Inzc`%X3APr2H>Mi`O+}q%!5t791QXWY0!. I!qJ^P>?2EDc/g_g8|#>"~B\\XɞV\\p\ :2=̤i8R._p.E?9{ϧY0uxkHl45,JW{ğ-<6}8<;#"WTWgd4jji-̞5#XoN")sE-Ulrxxר"p5bߩZ̚,<#BkiAi&fUeU˖,:`mt@KWv;Y ߸{NwfvږYT +<IrY3?Yjі{n^or 7:Ho3ݽ~}M Q)Ǒp/>~.˳!^p}n"FEYRPRUb:}U۶mѪ)^L(-H<D yC>}_oKW.+PHqN^v&ZJ*ѻvݺvඈ&:$5K69p)xC|䡑 {ϗUV?~jjBU|)6Xsw¹& CMXe,76ERA*)uP̞פAӁvo-s>6i@Wx]۶D `uyݽ}iP(p;wf67 uiG.P@$9HQ.Jw8 es :GgMLzoۢW]pgb*"fp ˲}kFd_}pB綖f.6jtGS܊Ncɮ1K/>WrYX ky $Ti~u0twy5xώ}xGA^P@gµ3Fr B!H}]%exAd `[um}aV*Je=٥EUm|;˺cvW^>t"nl.;g}=vZZ%, 3!Eڷs/MJ՝[WմԤ/&^J~&SŻ^I .{]5@`qrbc\o'q&B~O:tAبțT]#5sC.,ϷZW{V8tcW]x)x=p|iVV5mn/~_\&Z"z~3 =]xc_f=v_/Xk=O5BY`8t/Y[V o-$ |՟?{FKKJ@?=\hK|$6DKt e@Y]4$r` }] tkm`0^NHnm@kԑ#g~y㎜Πj{9E%2nD]יEń(ӽD~)>nEZ3'R7&䰡W>VW)Q p++: PnMu]Nfv+܂coEo5v({k߶o4jʔS!rnİ8 ˺%] #ྙOx>)_}.+ >yұۻ-TU3XJe~]ΞaJ@PֹP;=zkD{aظmBqJ0Ga*-{/]$>7KDy< bNXp!/Rɉͭ-Eq8 5O:avU!1pi`-? vngi%h.jc.3K\-&{]^^p&"'@8fբk--/tҨb ~w:G8xС[6`^LFR0 Jo%%eE%y9yܽ 紓y5Õ˾]4[ћSTZNus1eҧMd Tsdk&z x-!DU5R)=@UaZ=dPSJҥdHv9lwRR?vpXSHzwͽZ2o. 6vp8a_ڷ%@+޻Br_t|g֬dDG]c[;CÇ JN$IE } Wl^TE/\< C$}2NR֯^TM7~cY<|PwVzF6XK%6TS#Æ5J6'%]1bHqc<mQPt {_6[ `;7y *M|ۊxU)>[,x%E T0x::-x+;k&Q8&&j;a4EG쓕ݾaO %]sWrP<*JΜ%R\Y4޵c]9Bh/Rڹs\_RFMJK?/$+Ož@y墅9Rk cNDgdf(sf 24O0 ɄuIuլiӳve^nW()*ƿ ָGw"YÆa?>|(v~3O͝#ȿky)Ӆ$ezTJ]N`mgbW3oL$()Ծsk+˕X>zǏbrsPi!(-1}@=A)])>o3qbT;"Vb DNƂ+WFǞWs9yƱxq 5^Q ϯJۻb(Ht!!yj͟1#vFzvΜS\֨N_I;H 4@_ͬsvA5/畖|V76ܖZ C(lF<Ȁ4515N+dTrYܐy.@rg;vE %f[ F!M%6E捫WEOW4o z5n޾unD73VC P]PӣPKs|liJ<KAuXp㰲 >0a`_g/ЯtwoXE}(c dL,9|bRLY _|<rJf6on U[ȸ7v=@w)p~o+[c=8ծ/$.۩`$/3N$L{H)w4Ω#)68'U]#G\Ĩp+tQbZe뷮ޙp >rC ΞFd#H2aŜ>rtƍ|7\PfDTR-;79Gl\!OЍD ]r0Dvзc4Vرz(P+`!k@x4۽uk}1C6['qBnQ.͕of8{?󪷻:}6'lѲ2اޝgYUYyybd*՗~W֬^D `Rsh`l_T(mt1 % X,ƩoVA%$<ênZsPv:UoEkcu{wEY9UK{/j^gxfuе:tWk6p4 K}CHszkp}C% ܔ𖆠@r 'LAXWCJH8AXC =Chj442"6Q2w}q.]Q{jFjj$+2%-]B7յLEBzN;XYym{/&~gUWD]߿Nv0Z  nZC0 f_R^dH`7(شR)y5c`@)iI2e&N X31MT''΢3._M+?߷w9slڴ{m6ܲyϦMcbNVordӦ:n!BvDLhV( -Eel z6WzYϦ% 51)J 6`ӻxdݷqF)S Wӣ=p.!J7])UM;w$Eaڤ/53MmtW|-8Oؘ/?t% Ág>UVNMk'?VXV>kdU F_ ox=زhP⭻Z񏎢ޯ{Ep0E^xÆ>:`03Ubz%E%| 5T^gƍ^>i*81%S .x8_ Ӏ ۻ4#s< MWS2-Љnņ o]t73 { {q N,&R.ҵ㢱)l }gfOD\rWznCóP{祉 y5U/*sn޺3uʔq'TVVuGQ;}Q.[xs}Аƞ];gLwO tw*½CouGgqJ+66K}ַ#(;#vOsTm?`":]A(ڹLIG]z5pj[e‚8DxSɍ[2]CpV䗺 %k׮)%&'lfMuWO߆ֱhNdž Bڔ̠ѝ ykl jxe>B+#^P_.(蘸8|5tmI.pE(ZCJ׵0FGA5=oAzD6-,Zg[hWkC=(hgt>{HkAm %.&>c{.#'EUs3TE8PRx55tR3=msCr֊JΖ7>8h)-o9$%&=O}-,+7Τ >xw_zU(qJpZrvTy]c׭Y<dpQ5sT_2ڷuJig6S@ %c\JH֠&>ܺ'Fʠ[7 ҿ-t HrMlw?xwܧG<_O/\]P񫟼sH1L'_Rl=_khF:*ظc纭[sohnmBʙw؎SzPWYuj^OAer[3:἗XʺKOu Çky€1+=F*Hm)gLOUk}U,\mnt t)@ݯ͵kVK;}ҍ ]bWS͙ڳ=4$a)k1mdrf:hXIHŜ"dr 7ibpad #*O.&?)*ȗsPGw2:l鯵&Iͷp֭ki3޻c>dɸs J-EBFֲ%_znՊG8 \ 3Ι0q‰3 kiVŖ/]૸TL[ l, <|=ׯYca¤OwXyy|fV@@< ݶa\9pP? ni@ J6J-|1O|>xQw5nh351g<=m-_'o߻="#Veڹsǹ ̜?jo̙3sf8v_N:u4 W={xɘ!o7LdP0sp s@(uSmMw5&k+7"@+)+tɏ$~!9gg77R;'5=K> ~Gz}z]2=&!qʴ5SKRݲa}ԎKWRĝeWMx;ƈ9U-sgz޿?{][lIp[Q@XI8+"bNi~aYIىݗ'M _3I-=UlRQOmdwNҁs[7pF@g]1BE.VP4/.Weg OS:cӄ-3cN:'dvOJ^zդ_-XDN@:|xgT~_Ƴ/Xje|ǣ1>\[Τ˱O'^`US.Xlˆ 2V-_vDνǏpSZGyx1EeC/ċMW^---Ip. n KP@6 JuMOby¸mu cFCT~ 0Iᦈ>XDeE(&.)pIYYv|/LenQӀW9Lx_7OڲݏǽWWn!^v㺵aN󑬆J3qs )lڻ{Ϩ#>-i]wg̚.łc+3^a: f&Js_d Ơ?SQcOBz6eulδk̡Fw{goOJnRDm UZ})){{|e3q]/ wieERcH):r<9L=~/}a81 +Үd4TKn'űtEI·=Ϙd[OqdGl 3#|~I&}6CײUݗdfӄK'\#pyU[l%ER{+DoޢXKfzMO=1Zv"Lj%ŇKY@X*h^JqDJ-ԣ{G-=}#/~N.~y{{$얳!_H6Ikbdy@5zAlw]>o.Agef6tZdѣGCyzڥZAiUV֨ X4y5̸|ɆK+Efs[̣Ҡ' JK(ہ ۷y.ɤ3y 7Slٶ[')ɓ:OǍhUHˢ ڻwf͝3{+W?p0C]vNi\88І~Kꚩ6xHKmbAy]d:+.aM>wk9vaM}P ۂRskְO{1rS\aHHQ$MDW#+,, ҭ BmvnPT"/Zۥ;eUJZ f oMӿ(uر $yݕcvy`nnur%SgzJJCT53;ܪ:~!~Ǝ:]W_:vl=g!մtL ׂS۰h|taPt5;p=qM"d"֑xxi~.t`a 8vb|M Ő#D &?v"nvaP:D ˘bZr}DRNq)_\`YOΔXY+[- MK8s&tLl o~޻o p,??̹RpPYB6=5 ZuYLhhx_$u;t.Xw 򐃰 ٓ'{;ha&! 76=<#y7n`7Z.) |J p[4h2`oqU[[LFG"7)Iiŭ:q o]đf}hrNQ<| fy[a^.} FKIMâWx w=DfN:3zcNC؂RaQqZEW=8WN{mŋcbL>/ضw߂ŋˊ9sܸ8q7ȯMMJB w͗&|}hԾܰ^[ݽr&r=ũrs=?e翬: \YF9޸(S3PYzdٍI+B6pŰecdN~1+ U&%7HWŦEDoۼa=\ eإe0y..FgަlJ__tM輣._JQNVZl/ Kʈ\~!O q)1j~-%bBdepBU.ag../jjIFEVBv}"=Bۛ͘Ǒ`؀Ib9L 6'\߽u=;Cf!@6X83iOK{vv/WeV]/{'eps#QRlFG~X)H#rR"~9SXie ׭߲q#Xgʸ |)eKwwoR4:t^FoyȐ$!^j 1{ ,IPy lVL7{0!Җ-H-7/~_*o/ʿ~̘d-;w.]r%? _~?;czfPn˃J@|٭; s k,8S;9$`lB7kij,6| ˉ"m/_N̜Bp~΁D&TMhn![6fi(Rkg~kIZ935$atřdN`8J&3FVŜ<"J0A1+jzk4(=^ƅBcˡ |O@XR rR'0y%sb1{t8\eyW}q*|&6.jʵk\e˻Ѯ>33>(1͍Oݛ/B2Uc+9G.BIߚ# "~9s 13p/pe#IӰQ'p ftvD=X,_xnU8[i%UbEm=?kYEsYu7R3n懋\` iS$/_8u5j7鹚YHa5%.7;+cɁ]p.N-m\q2༲Ғ{g>#+wԤdU^SKlw5߸be˲f(EG=taؙ9t耖MjNI`h֜{'6(ZhFw; RCPԔΜNpNh^Ћ{e𢇳CA|l{|3O@E kb`Ϧ  kw:OF(oxÆ`'A]U'SQtƵk"3a((8{&f`MW1F7hq x==$&H%A/&yJR_F(/tߑ;MxxQ~&K((@ $ݔHZ+)b^pmWH+ʺgN>ijaQݛ7;{m8صJUUx}ʳ*!;x\ ĕ/;|099u#ͮ4xWAX6uҔlnc g<Ĉx$J'oa}Ov[m*_a\ȝ))c >dcC>fUgUB9f5Ww~1i;EܼmBYq0Yl EB,XAڍ[ĺ"b l^ ^) \Жbm \hdȑ^ G/ KAsq&}@$EI%ЫII?k[ SGjy4 ܳOg\M#YmڪR?s6EMəVi2[Iy&en@ЧQSh͛̕YwI5fXuԱ^9޴IڞXR|U+тufxƗp49&o p}+KMŸ 1:X[TomC˜G"`7'=u_BsӾ* =L,pԸf!NpA@-y7-é4PǦZ۽ûǝ<skߺ|<%Uz]@~<:zԳoȠG? "4^|:?+kW( 3$TyF))?~:Skdk tʋ8;VD] R+;0%X-\!`Y AǸ!sH)bEEtAAJqd?=^DB n!|#^x?4r䨑{Dt[ F,f/\>iG ϜQz5i}4q2,*HDaoP荒6 iLx'R3ȠoVp'Ņx$5ķ  |bq}1YI;QNdEoÖ{0Nw!{tp 83adB>}"&tuS2%.yXA?ja}%ӊc/~3V6)X)_~&XP;ơ8Y 7sa>C=8#vw隥B-V_,egֶ;ɱ־sa~M MVj;<-jC3>cORUk Mv+S1 S?X^Q fnD`f9Db8A݌Ű[Skqlˆa  0=9.bGL5|Cj!].%р!\x̉cL;6_[~tAlj];^JJ0+R2?xcV\.2 vmz1CεTvv3ou(Q7n#lVuxG|SSS/ez#֩~=wv0[l;wSRbfe`HFQpp#vFE"uM\MrRof75d'葄 Ywڅbٲ8TH!8a1Pq1ҐZ]/hjQs @Q. .+B9vɞ$}Fptf@lA^e.cO^[C/ hi{/ZR}XniC/\`>QȘmpȴC,$iıHx-Jv΍B^#Pࣆ6-=_;Agb nI@0BLD9V0A'b$>D[؏o!_=` eVnfx_ǟ\V_JWZb>xw :~X:XƦ[HYFY7bAJta`Qӻ|ڀOE;ǢhO]S9+~ ցp]r>l! ̬sFOs`>.d<d] s*طl2JV6WPZߐVPt=C4A2x(sK'H>%3+5%iN!6=䘼ܼ~c[ 9LyPNǜ)b#?}Zq]ŔQF |t*(awuVt>%~ !-kވv@!T8'峙cUoܺ-xߖ3F[0]JF24-ǎKqlчM>3!ja/} Wt nWu#Y>Z̞6jP&a/PИ0+@5UNA[`-)l [o2A03]B#?4с꤭gcÌ iQ{eqOszns&e]wKVSsj7n܇zm/%V#S7B~^MGjZn7P~"ZslVЭ*⷗/|裄+)%]cHF)V ?,3 ]@L7t: `ᚍ˗^|Xd p 9h]Щ#P@A=70I| we+ Xmɗ6^]x=z;b!Ç5Z'QV^SV+i @C?<x\rhPUC;Jkk}V?yR5<@֭AJzv(4WӣHVuճrH5*>zBQdzY3HWY;o^D[Rq6~vy5 u]v)Uqҍ)@#/=EA9"5(0q mBW(Q}HDź֖JVʆEnuY8,W ;tTufѢxx{!P^ۥ_A$Eװ,}zM-)WУGe aSC=0Fq5'޿xQC'n29=mu&C uƻGݻh,`UsHup-,ȏ;mUŜf g61":d3asmcb4-_Y.+@10t%,\J N%MaUE@/_ڱjo7U ?U\1Ӧv|p#Z>$ۛ)UWV.EJ }Y t`oGlH^ FtR? qZe5]򷬤H`dCsнn =@C&h?/Vd(Co.ч\< *SS􍿜TvJH"w$Xb ݻdav0I;8pϲm>u-!SLT$B7fŽGW%m¯pgcWϞUBAok|gRZ>?'=^YYVuCz`#:l0j}լ:9iYٙS d|ZJCKyN*2P)۠W47N;V0# p4Ď#&NZqtQ%b[pɸ7,CJUx-Y߿ IЯrt(@] hwn~B˗U=tV@ܧڰnC)`yEm9IxF-޿ټ_83H.ԏF2^UR3O qB\H#?R{/>/%³eg-jnT;x\ǽBanHVROypsOHB WDپV*jcCaQ}N3VI-MzMD{5 v}ŋ wcǎ9vY>Wk6H!f_e߹gwmٺjb 6\Ɵ .]hkv<6q*//LرJ{=~wyun|8-- F͠5doN];S^.բC;fרm-b(;!f/hՏ YQ^H$hA!!*RA 5>Z)q px>XrMEG˜Fb+{i1tF3$ƴ@V%at '1[h.7R1M~ Dmz˖P=U  sep>1EěJ:)ϣ4B>a]rY1SRUiiit&hn)nU:h2͠5&SN'j 4ZX1?{ȽyKxlBJKrnHK;G>_Yл,yaG!?hxV_χkdskb+&Wau}ȷuyY% ]۷Woڼy5w_t= Zr%t׮j wl%E.!-EK}ESiZ02\QPɥX(͝5: }:NTJ6~]Ç@d[͠Gyy=wΏˮVVA -TR[N+]0?_T8E߾{>%|К~܁uq4 )*2L/+HMyώ7juR7oXɫU DVj{U&N?׽pCEE*{'v8-O-O[{zR@ϔV%Ysn"W w_iau-FDb*Q*iGGGo{!$ vxxz<&:W? "8yLqnCIƕUBW^^X%5tuYtXBu{oHiqrw_uɗx;o|,◼tWi/?W)V-_Zǟ~EO>gk,|g-Rg??-\(HrtUNдEzG :%\}}w}u=\d=\XJV3u h?B4?@"Yh '/?G?!UAQViq; 2CvSW-ʂιgG6%_~ڗWsiYmYIE[-,GxN>wmۊv>P_=wOKɐM_#;\T# IMCc}Qٗ-^ʬ-P\a( Hvjk 12 7s^bklI( jye*tv%sl._zᡟW3lD.=$nnaDžZ/S!B144LϟÛ5' 턖|B&,oYq0sgZ&Ϟ)k;>PCSs?دc$ cU . ػɇܹu6Is,߄"BOOkc#aCw7kHU+ɏyۇv /Svh ^T⒧$5ɓ3wl( nJd'p+遙! z22xk8DVt˦o?hS8;(NX1 I || {{Kˀe6oXs'\#Tuz+`ќ r\]pT; WNshWp/Dn{eSc&+p{"5F*p SB gn6l*c؄9F\`ρtt'*ѷu=Z{78NEfMvOOW3&CEEYSrFG3 e}{`y9!ۙhȽdYqxe7n#KرYtY =ݓizjiUbz^NSĠP054XaGk@Ί7FT9gNu H6G׈"vW @%O],YV^Q䁟ve!*” 3:. Vg$Β疽f}|觽'NͼNVŵUD$CcYzU= Tڴ2ɔ0viVR:\+L3szǧOrW#NJ G(OS#֐&:+w*ܙy>_)JItn;0kFވvqx>Z;!(O(:# f+"0rJq/Pl:+/ϖJpZtYM,YK, jt4hQu5-=X>JU7n6Yfi+6#?vÐOb|[上|֛\2HvEӥHvTIyB^&Onv.F Kcx>+Z#𸡒p F"R 4k`׮ZyĬ3KY~df;>q:K_faԞ1hK@zY lL}CdKCu,D3{vs}! |_$ W[#C+cIiyO/?]GL5O/X# g]Kl{԰8cbHЯ{䨾 4o[`T"P֔}ced"AL/C20 tUYfR(?yM1%aAa]j,9a9E #QSW%|`^:`Ӎ4>d~#kcF.8==1g~eTu] /O4ʟ;?_)xÑT9 ҴN<,,Rgd7*b:+EXĚcXy/Оl{҆@Mkt޼Ú#h#cqɳ7w)'<8~hr9SrN2y֜&M몖y 7tl^(am]Y!dh=c@ W{Y &!72g ,nV^p D'mH K+yH7F-}7ijӶҞ?5gjR+̰@3ۤ8̿z4=6T4Uq zzvꓕ)|mǶ2vhpV2U*l8uwjt3GB:zKS ~s3ך #Ts:kuaKT%W4uʔofkS5E#%i¤Iw}{Z;cտKN'/]\/#ʓgJUFkPY'`Uy2.ݐimoj crm Bo>!kR}'!ȃ,?lo>cc;>Κ8j7>Y0ixw ndٴklР|?LdD2xG#]GCߏn\BV;5 T:uRؖGf{l@?ssu(ێh˝p߹f _׆: 0Ak;tDt[ΰ@m6o,7TT&“t|瞻Z}d1BSǏi=3{7mAƆD"L=R}hxu\^tã?{KI*e2x9X8ͼxZ<5?n&vʊDЗun37?ۇTp%*ٌ[3FכEүi>h2urvV_H^u }<:Z[˨hvDLL<|R4Ie{%d8̝ #eqiꚴoʶN|yb_k_Տʝj|KvD#,RΦ~ɦ9s4]PTÅysyq)qDH9Pi4-HTܧ)/ӅYchzrC^s_ ]{"?R3ӫφ.Ж'M[yo M=Ne1pHԆţxztS.uteak_s\cM7q׎&@Vq?t$^_NDNT]|(pgyynŦ];#={8Jm/L:ZP?;;mZsc`o$:ZaSA{Y}7qBŅP{1GnWG9*8ɞ"Bzq޽ mvX0sN>f'0:ۛ[} ?9R endstream endobj 64 0 obj 49874 endobj 65 0 obj << /Length 66 0 R /Type /XObject /Subtype /Image /Width 226 /Height 121 /Interpolate true /ColorSpace 8 0 R /Intent /Perceptual /SMask 92 0 R /BitsPerComponent 8 /Filter /FlateDecode >> stream x{U_)Bbi `k">B1$* y5<PQ$ STI$ H@PQ_{ݽf=;gf_ y!/gɟg # dJGFvrGi˗/[lۅ wqO;3sƍo@u=#rJdQ%5BJA3I)⋅cVQ({/^[vrGIJ),XK.iBDs6 3)m "ʮ|cӥn'ԲOkij훨D'S\wvV:e3Vh߰jzR-P=j͔d,P{6ok SJwaS/<'$/?6iů5҈34ѧK7|lUb[B_c 8 Aŋ=+v|  xcj㝒rt+?wエψ[ߤ\^ ^HI:>C;Uٲ,IƵԛɕ+/b\sy3DYol.o(k{6DRG__{@7HDJ9y<*zT\aJQCYB94lДF 2,k,*) C`RG-~ׯ}[m!Lm2RR -7[P+ԡTpC)I])nBR]-(Znp>rY,Fi!^=%\{ ja%C)`0\MJ9cbE8FKhu *pb $ڻ2RjvdvRK+ՙwR@Xd:҄#Ƨ&`>0adz$$.I 8)^LTN6K)Z8*^RtDE 2a֢KBdP[?n E=F}oYTu K F ﳢ25P+&VI I.I1 RSVu(U  Vf@mur\` veYa]NYv;nҡ5PLU̳ 8vȚD0(u(ĊLP|V-e([5@~{ RV:U9Ѩ!'=rQ*duPPS-fˈf$ʼnIay ԂQC_I(lSKGFN @u$Xݑ 皍MҭT:;6fz< '"6 Ǖ!Z'*$ 4Kik>hҖ|fIhN>hx>MƒE[x(˓Af%Bǝ)?ސg-$5dHBLyq+nOivjJVm"Q.{cl6ĽU{Dbyv}0U昔@]hXWL` _,z ik.tU:HRb+Y]{eҫPĎx&(5s_]Q+D[D׮]aÆ+WjrDZ% tIlmYT|I}DYDو5R* .zQS[=D4)(>5A;`^$Ck^MB@KmlS*͉ GrL84 )آlH;Wg)-@ kvK} ~3OJ0XYaĔ.hmSaN`RCDc':4D{˔A-Dtɒ% dyJ"eQzB$̳")`Q`rh 1RӉl9AkWҫW쪴\O ZhJ 3KDrRTٷ+RSn҉)UArMbGNLGbt[N0*asW}-OZhJ, YQj4ta(5̽eS)%+; +09-*vo8!p2*s^X=SԉCtLP"ZROo /6]`Cӱt*lIL)r6o&J`\bPT2 gj8AM 8: jDǧI*8dm AC"YkĜĀD)ah38;q;AYc#(DRW$C;uʜ5BogJl{gR]aJ O HekSԐ:oFp"Pѡ@h5<ԟ:5u(D3ɏ&S@PE4SZPXyƶbˠg8vuֽKCusGvճ?XtI_W82cFYDu^ zQ:5 Gyx{[~qwhDq)M2NBT-Pk")M(_>;V\>?]xV.:qpm/=v>(sӅ]ĪKl~D?W7o޼5F胯 v੿`{'T:~z_8)4Du0eV 2HNvv FN ehKS@DG >toty!:+RʲU Pk":,I;[IVx`El`nV :PVWew{I9';3On^h}P+-ڴ]HipPS1u={֮_&ԑ j5a›BuE Mq/'1j5*p([xƔ}?wl"@mс@0fIL o_vYx(%w=AD+@iR{(}3gs%U-&9JQgPGSO=uܹu ]x,1=#K$ǽ-~UV(f?{7}5) '033q#"ӯNe鎤J+D3MQ")DJ[D3Jivhtr)m> )hJSD3Ni:Ph5YNS~'A* oŏA1oӟZVKP05$oL?Pd-4RJegLe$dM/Q@C=TޕX{o^8|`ͶRJo֡ʗlD)J5C*A!GYrF[9UB6Yˡ7t h$E[jJ̓w!װ!9 6zBSک_@b"oRش `P3d, ZSKhA'RJtCB[!䪊TpJ>c2[DGW*GjIA,MAN32k*HM6G YTFh(UƁlq>ip^4lRDRvUPM ۤtXP{'b Φ]h:Aw1*nI) uٕm#HZ>GtJul)^if, T=[akԔaE(OiP'ѡ(oEɣr VQOB+$SsR]`H]PkwBi5@J_S!FԾj!+VZۊ9 FgSq^҅]fŠNwɧ";$j#'&h_ȕ7Q`ZT >VlYtRH:dᇞr3|5CR'2hd tKPDT T_p|fIRHͼ<8ػ~sǃݥ8%RbΛfdǾ4X허1D39֛&~/ endstream endobj 66 0 obj 4956 endobj 71 0 obj << /Length 72 0 R /Type /XObject /Subtype /Image /Width 140 /Height 78 /Interpolate true /ColorSpace 8 0 R /Intent /Perceptual /BitsPerComponent 8 /Filter /DCTDecode >> stream JFIFC     C  N" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?(=Š+'ؾ:w_v>u?Fn¼2xwV][쿭̸29I0w- ?|v~þw[y?_fX<;+>en![5~_g{?d_^ moE|/}?~;k`Wmc=CӅn0G9[U5ZpeU(Kj@ :қ"|Ek'|vkhg}ﺿ.K7 w:қV>"?i0}AUr_[bk1͟g7>QOMUJ%%躳3 m[2y& jFF[FѾ|7|it$2i:LR60qzFF rUOo_?q$yvCe$1)' 2}$I& jI]9B +jO 3ĒI&()SFMY-GF+bgMrwm}Š+| ;xP&SÞd%ǁVN7RZcP9$m><;Ě2&,/V< B3&1 ?i ӵ&ԵM>9F,p0Rtg!7l~cԵ)Tyc%裁ܞ+xgWq]_C߀|;b+c˫?袾?6}Ǎxv>u?HWeW躷Z\1fK ^ra[~g_~;|{÷Q+s:#?7a_qQE~GfX~]<3[>r.[% ;J;?]qWOw|~3 cǐ[ed/ط+gnA+ap_k.Wu~'fY_YCE\׋Q[y) /?AZC!V($I$\o9C,쯸qFN%'+> b'a'vZoe \H? g#n{co|ki?ʾWg߈/,$u60%w#L0lTni5d5qQl)x(A7'ySm~GxxMCPOcpd%w#O}|8ǞQeQ_MdsrW>}CPG}69Cq_g3ZΞ˿OS%"M{A? (t( Ƈ|{÷Qq: Fz}}^o~?T_ -k?ii}B=aBn <||랯e+MŞԼxkVˑ˞hlXᑔ+1̱9!֬D/SkcRշ-WQ'ꚶw|VZj,f{!S$w:G õMp@{~Wω>.x6/h'nR+;Wdcг$:AG!&j9-lZI4NUthvX#hig,3y/?=ֿ~yǜ[~~_FXaiT '"~|ihּaek_Ħ(ʲd@wڹ'L> |5< /xwxOCmާy,)ZX|b}6;8$ 龎bji/hBwmw{#5sFq^*1#Gn{<_|_:4G֓@uDͮ8Av@xj#W읧/ X"mlo.$ 4oڌu60$L@} EP{%ʤߵM?J%]wW?eri*|%m=ΡZY[޼Mh&L\ldA'7^o|Ck V5!mFIkdƙ>뗏b?f_ڏEå(𧍼*! x-'|6`co}{dMs;k?ۿh 4:+| 퇏m3~xI㙖ym4iD{e77.nwaY/IXS=]>CpcYKHy&f܉_"_3J^o̱ς-n渱/|=Ԑ h7{rCET|C|DO q?ry▽hYGhUٽ$U_;A φ?&meIOkFMBV5[ VX1=';#?A.B߀?eKI?ٷX0?{oZ`xW u~߳*WƯGMMye5{I>o,Qn,M"͟R?n~¿-<Ҿz|!֖j p,,cWPrC[ZX^ 7|k$7 ᯎ< c/AkzensOy"W4ɾ$NӅ=/2?;?rKO^6 $+[# I e,Ϻ_=G@d\xоT心jԼ7Bw׳o,o%eo'˘JRX_PocV//Z>(xe,<1̌#;%໎g -wp_F?b+k>w_ Nj[F|>oj:?߂oi7}kg]ŨqFo2qC@>?j߱OگĆݗMfR,-_VuY巄0MUTy@wwxC6~ZM48$6_,Hl5)#2˧\$Rΐk_?f?/HOz}|õaln%3[Ze_{ u/¿ .|KegSn#\gS|[Ɩ7Z7a;j\h2js*B!H(fU,FYG#-Wse0b5dop^8d\|!i1.?i߷G<-'Ŀ/*OV : aej#BU!?go%@-oϟ/]? cw/4Ec,2XJ䈮$;(&r?CֵY?/_ ?k VM-P2C+RX] i/KOf~֟ 5/io2ּ?k+rVl3[.&a00hI?=1վ$&2}[S}_ ?jkyjlN 8Y[٬-f^By$?FK;_z|#GSԵ&$kghwXc__D>?o7,f=+o&}?dzۮo +fj0Gl}_!kxO玾(K>"퍯'7_h:gKX_X uo;!I7X֯/7új̺6^76ވ!.,!7J7$J'~ ~ܟ|_9|Hg_&¬ڍŦ^kVXψDŽogh9?"}o|ao|,{xCK:$x[tέ6wr4_%&0ﯞ৾!w|l~"|4SºKCxºݨfehѓSKei,`܌@z׆>3w?9?X|@ơuz.mg4Y1yQE,jdxu$MG|T~@bKWվX{LѶ'U_ه"9&y&Ҽ8|,#mqE#| 2ǽ7BPO2?>':}0?G-@f>/ּ(FxX~뚖GrYgdEt,rucOwoV;\u]]"M}r~{{KkP` H ˿+l/Oo|yW|B_#%|"cUT$rZhf6t߷ƿ߳oϫ>"x'x9> BoTcht0x3,Z!Bcw7 ㎷{_<'aooa˝rK]5QtVP⿁غݜ"|MH#[[^,,!u۩s%w#3?AbǷٿ ǿ~GS¿ [.+ ~o/?_Z犵M!,^)m<$~}rnyTI_7㉼gxㅗßZ>@hK7dYT[ιi)_Lb5X:z'u{vsa,kImmneIuK?/_>ޟ ^xDf7yxNp\k:ʭK ح٣2^o;g_ ѿ ?x/¿i{i945Xo~[Z2Yk7 + _'K>mK|Q=,=x Yt5iRk=*d<*??? ]ax;]x'Uu&5mc%1Ij@ҹ>%~=c?n߄+x7~"\Ix\#3f4q<:ٮe{x_0J?goۂz/ agalſ_Qki"W{먴Ux#n®}ɬ]?a f໋_> Mh_K ΠTU-$Q ۻUo/7h>n3Y\h.^V+As&͌ 1 &7uy;?oFt endstream endobj 72 0 obj 7598 endobj 69 0 obj << /Length 70 0 R /Type /XObject /Subtype /Image /Width 180 /Height 90 /Interpolate true /ColorSpace 8 0 R /Intent /Perceptual /BitsPerComponent 8 /Filter /DCTDecode >> stream JFIFHHC     C   Z" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?S(Bq@ E&FZkP\ C1}eq٠ :4 SZu#2\\'jfOF.plwwʎ؅~wqZ>~&xݧn[IHO,UܕrdaϨGf6vm5MYϪN"͂Ur29֋y5]fʎQғ[/3ąGߕ@ *A;ui|t#rULWk/۫z6G/4䶺K$[kqL+0 n FIr-[XE ZikVJn㻉L9O9#/zZߜP> ZQ8rU>axi$K -i?#T_lk믆5 k:5EbDC%ռS;pE`)L;z#6i㙣 pѩ6cS<4sq{_i>h'|;6ښ\fsgثf@*j}SZ/rJMC_3l=zWߴ?6x;DiU^A1}HtkjƲ0kᗣZ[x9Ϧ((((O5~4OUFKZ@ʬp^@n'!LwšЕfKmu*ppGPqր>jqVxo?w¾!:tx_=KF𗋼K6[?F5=[mVIeDlhG$!Nq[V_RINկ ۧƒ|# Ǿ=:=~m휂H_b;x<3iaxCvH!,Y,CD1MNƚt'^u>? 钬#o<#Lvjw?k]/}︶/-Ha…NA_F|4SmIryH#8¥ SC]2"ijc+||gu{6{vܘ3#.qA=Qgφzo|{\!2.f` p0>c]i@ 8"TQ(|m,4F3FFr R2Uydpif>{u iY;b.:ujoj7K'[B;OiȹLtu8ݎ8GËG\%x"%4y d=>Nmc-1/x;Y0aNedQx<$8h;:c~>1Rɱ14:Ħeh)j|(((+j_$M=h7RC%]#.`Az.icفC_@?<ozN|Vj;[m7O q \HUJ_v~Zu&{kE]*N-۫s a Ҿ9%$Mٳ}uKyfb»kk>5xx 3EQ %(Q–w5*D,mEԍG@aW[|vPi̶#.mD)9S+nc.DawaX+'{koiV~|]gZ]TV[etݜIڕxWv̷zz6-#xqo'qϭwp8M|q~ZjVrOs:~j~}&Ys$Uoc@>#xz7ƛxbkȯm.ĬEeSFK`)ӜB)9n۹-7woQH9(!ra?nF)P_ R-~xd_ͦ4#flnI$^h~m}6k Ŀ*lS wy7ix[\ztڭEJ%a$U4nTH޹Shl4i4 :ٵMB{W56]7M4eB2x t}چjfWb$i71vҼK7}/']Ӵ}UcVѣ[b{u) 09r7ϔ=q@럶f]͕i^ij"KLO$/2"@Xm`N9|uxL0Nz/l4 tFOnL+1c ֶO~:o.o-YjWi2HY̸(˹PeȈ_6WkFt>[4M$G@C9_R58ƥj1IMr~Gȫ Љ!۾>x^/n|1eg]oXMD/1iIdtxq;y>>;;.]ßaK.< 3U$R XN `|Z^]_hs}SK<00hIIr7(Me~ kfKYKgqkRkth}y-N81g$׻|1sfw #HeyLJqKM|7m}_k:ε}kZ9֒<1Hu8 ÿ٥B>sWZ<1.|!kQxoWzAH5K,U‹D-86+1Ƿ$ El4x0Z۪r8t3cI=q"X*UZ@1K@Q@Q@!4_Ɵ {J}~/ bX4 &{Ofd2 %9`F#&}2z'dtCtj]˺;ib?9E:/MKx_X|VKE@Mzn; F9PePqy~it?z4$}>(rwyonp=a2pGNL@p'|{Gu_oC]ڮs5Ζ-H@(w95ɺ-_?|+u&ADݽ ;[hb's2+ݾ6z7I!9·}9#c"񞧵?~"k⯈~#/e7zI2(~v> stream xgp\%1?66b7:6f'bwG3ۚ^ZRXH z+aY@O { G$hAD"}=Ҩz*W(Hd>s9~,`148Y#Y?>; Y6 ?=Adt \~f60w<,XY˲ ~򳌏0߇a|7^bAI |w?+} ' ( K~sp^ |Ocxso?į~Dl^>0x[cܬ 6A@$[@,>K.70~fr-BA./tvu]1O8&  3zWw7ģvt X3V(g} l,:} ˣ@a-y}>#zopF-x~?s}^_! oV73pZmcVlbLnbз=E#mn; ;,.e0/ P:.\Awhα*|\>.`'.'8}_ wV|۸CŌY^f'caum XG`edLNZX4ii\bL ~ ?{j8d Ax6 0k. 8~2a5>9ӯ<|o_F󶤆X]z.UKIk tiѺ՚LX|C1ukS's_y8oqwqxn\r1Vےۯgd!$7X'Ma8Ƚ.z,pģwʦVu5iQ )pEz2-JЦŪBDY:9\:U #)uw?ʍGΌZLf[Ϗd?Σr{*#GU V{3s/t|vF<}*]*s-JTI"Te*+I!' jQFfj?vLcv]&YIL$FPII?MZAelsbgne8B{l.hqBP& V TK(*9JojiF"H5T&H)Q(mZ*5U*Rb04R` b$`XH'_ w4*Llfz$^䇹 7#hEhT(\\*Xp7vi/5^R3ND1hmJLT&9j#^D@(p% R#,]:]XMYKIP50* 6$6 $L%^+_՝}P3ؽO]*RJ(Rkm_װq%^S'T+ׅMKW2ܵLA(|A 3GEL~3{5/oGiP&S# ;j1IQpMX T%\%_&l][ҫnpܤP{&~HM.\m)^s괕=u2`"`:0nƍtRk&V;VWV!悰p|a ԑЮc,tFXGy:Zmdd'~K'ILmH $$6|PJ>cd|7?O|} .$(#Xrh 8L.GVW#Tڪ'tWRieip$ĞKԖ/G CH{a̎WוK%.g.Xa[]M_[l7"'tC%!1.lUPǯoQ! :ME//݅ F4 #oJ T(R!alQ~ZXEWF{BHᅽp >ih: "&Ȍ͑$!) )5[{$R"=Ѭj<{+-al( =8AHÖ> v9NGqeۣɋ_k!c(c )+u?IMWgfRYU)J2@׊8MUE[B  VJcxzDd!ΊtrG*F0t.,Z9wEmP#ZET 'lLĩ4d"-D(x ^H\d 'C 0Q&ϰ z!: 93͂^&zXJď'zHP~CѦGEVXjQ @M{ N z-8'S@OUiRwJiZAI~{uZm@+MmH:MVEuVNɢ,aL޻RZSi4^3yqUt sUF,&Q[M%ћ0A/SR_ye(л1%J&L%MSJRw]c| /B]P%9z.0؏c`ѹ]fЙÆ;G{u#SJQ@l%w(;USߧ5J!9ZI_6Ÿ@y[%?'w䆟„CY\g 㺖Xltzl0PkK|c/G aoDz 3Mo zqn Es/%m%F:%)@L% 35[#0!Y^GL ]xOp_a}ZU)0Xsv+WvEyBcQbA2 }- j5dEsjcSJNH-ǏZn-y~y׆ek^еX/YrlEяc դz5њDD$Si #K.WYc/. #'q+,}7x1Nm}5[@M$Eh24I:Irc L&R2jj5Cҹ+k3X-c7.n/TԈ6~}H'CROYsKÁC6Uff) W51bkQ$tc̦PMR8Jox*!JHJ6qGG(qz^f@8D`u$: OFYk_C@_K3!ZL`!7ah惮YŸHI0IufϷ 2703'|9&7 uCڂnsow;fkXXл2'^_!%KR$_`g4]#kgCA`n~asq9\_YYahtk KyZ|X"ѰB/Sa%}=\hl%K/髫\e/mOm.ph}b(>CdDhi46e%u a.=JQÅ"{[mw^I{R)*]2{pʐs6Ȍ6?y3HW ܀mtXmߢ Y,i\du.%\t-^@/tIa+zq3[XK;PwAUŒz>3sĐ$$T]D)J0mZ*EIͤRi4djUid_en-EL <0B\6&p/{HN·E|Ss-o0^`S s^c$jQA8%q %Qh13fP `Cl|1%i^&rs팛lj0 sOOX<** KӁ~%+е[r 6e,.*}@%sWKS1/e\~=h%gd Vف45p5t-&$p8,+HrgM>7@~Ž&(CdKK klaLՈقp,S-i7Xm/y̷W_P$!5P<8RRGTn,[IX #Ղ05d8 @/ɏЋ9'Tͱ|`ZiXXPMYEOxmyP3n<0sx6:^=}WIK2}bo9Iqjn7h۲R+uj:%d5ҹ1 Qt[*ԊY$.x+ӜieW'"uaqxھlyx$WmWa{ g&Yˌ߶׫tVIL7$WY _.vIOuvql<viG{^T!tO#d%K r}'O9x ?0BjD& xcR iu &ubkUܓ SY?u{Xz!e z#\Cs;޽_C 670LѻAF5): J;ri{ "QƩt@ En֩; Wr#73+w]b mu2ȵ8OciՄyY-(tY)2 ;^~M颸5W?XŸ ealXU&-v:/@uۤJ69|9dz|Q(^,-=5".v>yT/2W$6Yi<; ?tO+OX^t%[5-Y֦Mk„.+Qfdz45`F l"U0(B~N x":Eر|zI]s] 5Cu:/|ؾkNRdWFK\V6E\,@.k*, #+B*3AL%&8D#Z['jؘݙ{;30r}d$}kDUF-KC3Lv!OG8 ı6긫qLp-\hoG](ZYT:=)p(8.sL'b MsuK86v)5k?p@B?gͳI3; fQܥ>9Wmr$SŎhXf gK}4 ƽ߁^@6F& )F(]4}z5 wJ$hjtdsuL#>U*n4T BUIqou5ae(y~'zuMBI&U5M[ ^6a$Y}^F/ TEB_5Tr`bjUlz{//d^^+PFsWJ(~Ԯ[7p;N?zP1;]!jpIo?h Q*#YӰ|-]x}]Y) y|yR[UZŧSv߲T;sMx58r9-?e-JcN5v@W]4~5Skz=f'g)4kq3IN[bX*UD5 TՂ Tcӳt)7 Gݪ=.O{,G~F׃ae{ٶảퟧ5 nXP%7+TCuztn)J|m= |DH9n*{^baqMg WbbMsmңn&ñ5T GF |c=r5°kQ6푩9tR91WSjChw׼ɫBs"\OO,.:L'kuu~1\c_й+gw Y 5)=sakn" &p96t#ʈ@6b^# [E%A;%FSt`ԺSF.U{AwΚZu#o2:~8ՒwT"8 :F<WjSkDʸR?vq2, UtB4YPaQ6fnULa^3HXe,,d/Y|~8/dҵsxzV2$acEiGdJ|Z{uQ=kn{z^LNLN숊nYoM]IX,?m8:Q(4MD<)偖~8 \>0ZK6M\LUb#R^_2LsᵗʲʢM!Y~1RAưAψ,u3.{;tƩAfu67g%5M½>C.ZZu!0l֣|z7Zw֩sv[Z\b`|^ͨ `Kmd'RPwk\9\P}% ZFG5C~\}2'K_vW!ZPǫ/.#kZw SG_paۂ^ rP_صo,%Kkݷ%68Yu{6.jXgΊEɠ{j'q렏6V0Ek#ډ@W6Cu^2^~,8cMW+ւXl/$3Eۧr^v0?8_A5y|Ǭl9z$Y R wY@|}I98ƣEU AI4ͼҏ^5=LjMD.E(%a1 U 0Lf $,AdBIօNZn)Yf*\a(\/s zs#&+* օmlwzq#ۀ׺@= Ţkw8`_е'/.\yTu\tCAd{7M,>%p\[E :kbw-- Wq5}UVhT|4h WRO X NɨT빴z"!4ץ(٭H{_Mzc:>쓏Zm֭ÔU(If7; CFn!E1aSsBr#T( 7lkhT.T!  狢IP[ Ja&KLe6bn>i ĀƺPZu8Pg'x.#fO6i}{  /`z*+O:<#-ʜ-^m9@uyw -%-I>`C0{3LeL&M1c6 i^e2?ykC#H9v 8~H-}ףQ?@uفA𤸫``z-!ŧ _K΍ˍ'?R<%Kv#-H37"4!/a^rRocu)i-RmWQRQ$A.M&%бNiX"[z76%HfAJ7oݠSWdd\ ^}qAKsVϔ5S"7>MZ߲K5XgxFF[8 qd`6"[Gs]~kWwK8Asv΢Otc 6Q:ݩqvT o?E^E`D2>z{'UE s7eҮ IKB$9::[lVHHow5,pTJ,/1ЙϚ$ ɡD9A䥿O2V7R#դ’()^oL 02JE_F,&V^ $Ҁ8D҂P5*BVRCi\NZR6W’ i:'KBc}5qXTNGڨӕՇδybsz t_'-rwy17Qq;iM-j@^ɺi>&b,7A$8 ~}W0"[3LRy]OcjD&( 5hwX+D0mq +Y麁 /*>ֶ| WV5 }wyήoKdu^ BFM^;cf uo9Y"Jubxl{%4kncTACF2g1㨊{%At:/HobC&T @[ A62 X!c@4lpba耏9g]t[Xbhb^Lԧ!;xe-w<; or_s)GՌvP.bpޓ.8 \qlgqx Ћ=XM{BgB/u=Aoj A2$p$ @oX$EJ#ȷ) kR+#e٠is܄?%Dbr%XG^57d ܷ#-Xs/N2Qrᣭ6QN%ER0 ˅!VWFa58QHC ג*M*1*e&%y -٢P%h[)%:nj~n$7c9k\( SM1^-@>shYto7 JeE6zva8~7m{#A'*tp:3U6{DG V"*h'7 a$:`8f\`!(k#Ra8_~H z:z}4+jbP |J F%P*yybs}Xy}u%G:sÌ!Ea%FNTo pAkH4PDH;Ol kl z~i2"CP1z%4xvՈ`pePiH#s"T¿Wa { p̽Q7/Wor9i5[0[* 2Δ͕3ptÙH2Uuy|1it:qAw80vÐ^cTtq!+)99 C~uZy PۼV r`5xc`a47_%n|䎃vR1(,9ϖ?LR '<7G7?V c$\8?Z8Ѫ$#&ۣOnAI@GrdAIkA ˟;b@NL8eGphsEڎa{-zŨB AA@o[ C&dF4c )1 ] E0UJ Nļa ?„I${S`.iNQS2tdVY*[>hLb0v8sqYc1~tV且SL%l<&НGM &7NB|TyҲ ha`$BvWBity'0Вu30AP.z {%M%vr/>럁1^iy6H7э_?sVwJci8) :o\ *u>6)H:I6OiI1ΚR'\V6sa%JN۬g=nY42 ^`ǭE5纜~/T) z%'Iƒf 7 ^h!Aﴃ*1z'@#1(H|5%`wx,0TKm[q (Q'l4T#JHѓy& XoC ,};;N}c2Aɇ6F5Á'Icc33;[4Cw3&g('bf ^Dsz1jVRX!*K1x>`jb3;"C(Q՞$7(`gc3b3Y gx⦣vuvd?4V76A@:dnXڏE-xߘns[>StU1yb71 C/QĜ ėTM,FC,Px'@/^ wYuV(S(CePvD.^]T3~]]{Dw8 @RM<DdpͱLD\8I_D1|Cuy,svBiNFTɭ;z/nt\j)1߉9zgm4ZƔU7^({--Dp<548Rޓw\R9V[TƬviT5п*) UtޮKxZxVLA8Z0Yf[k- ξσLGxPs+G_7*FAsw8Srg*;j*?:wʉ_Pݫ8t@MȏBGCcN?UJ??)ݱ g&yCOkN^nWRUzdH=ƅ擧jP߮Qu`;ApҗoJVWopɻ_t?z^>UWEOsZ?sL3OJ폔&v|GQŃU}RuvEOOO~pz _Cܭ:W}xϵF$?qb٣cߓ}ʃgn~:6 6|X~dmM됿Ekjq /ǖn8zǨF jH/翢`IwK$ :AxJ*QķD @>s{KſfW3QD9κ]מ6,X0k趺,In)d$$$$H 2ussVYsIx4^G+D!r JU#5gwaJazS^mUZJS@Yܰii;.D;(ITHoGT+aޛh}q+9NٮK?h+{:Q@I V4x9iG؅Z3Op~^xn`#Mc`ab͙ԋAXQѝ_4V&nfKԣg^W<~W-ɓ?T y4ݙټ)\|sW"J:zX2ּYq(Se˝]SϮLJм~r'_U ͅ ]W^ڹJNɻw3t,mS=AZttϷ}~V*ߞN>~oL;Xκ55 ʬ/Z$'rfSZLa{PA9PYMDy|kq)b2HFVUoz \Tk4)Q*g"-F:+Wߍ^)mF=\vBTsw"ܷc[avH9M&pedcxPW  FހlBaii[A݂[woִ?3ЏR2Iq%Hf~k7I)zǙ /onny92UTsP,ihk''65^ӗ6\s~jo*y-6W_=~qbsHkһЎ@P'm=>uTŌ x6=o_7c5cTNE?)iJ˻ۧ:^,ڲ-J;\aU_OckOed>,;8ڴEy8MySI@{No%'%| iwu~Wn,@g/_,tm+dL=_єEr܃I1GiMYZ6\wQJaBug2377 $czCH[ToģW_ az^oЋ!^krڏDMZ( l ^ )CP#Őcu@wjpZx+!#5Y4 #yÕ'+~^SJ>+6'`y0!`ĈhQIR:ٝ643LNLU'lQK֝ju'ӭs"Krgx"`0ꂧO?Ө2UuxG_<糣au1 m-c@1ٓۛfVj{Gp}5uszP?q{zcnÅޅ3w\ʅҽa<6!݈fǮ;cm)ou@_ pG'r_B=5UfqcwTAɒeTM֥~HOhZ {?VVT9҇WA (EGjoa`wK*EF5 @k /|yqrq m[)o?38lr̓E >*G,4]zrAaNeiRYMlȜ/lpWSVr:pozPәQ32(v5/sԥT}^l}f}] @~׾ڄ>D{+HD GZt^-nSqfmKNץRTGMwl.yЋ8hALK(ߢad` 1N|R&φ5i tQCflpRq&0^1\ w4]ԑ'$f4_rм4l1wv ^=n;pHNڲC&9_w|3.i {gcO T]GsʱQLoÀ O:oD[Bc8 sUMY s'.8K! umRdහ&`;~^=f]{:tF&tށz.~k"0Q&Qvʷ>˟ϓ~yR%MEuMs^u=[IW5 IU RUҞ']_ܻ?էEmʝWacwdfmrM֮[,hyXАTIz>P!Ry[k_{וS[vkkjjkgeidrhbCw !QF ɖeD9`DHHȹ:dT zuۯ{wu"Rp&]ݥIo9j<[S&쑖w-㏆3Ή ޫtbq*K'su]F@>}jEr "J^d33+;jw6d6gW\Y}ވxVb{&6X!HFMؙڏŢ85焥ΐqГĔVuC~8PW\Wx\w@WX QeO؝7[wv,J>b |V\qYޗ07H00𰨂9Z$o2Ćj gj"c8a8ޯ7%q/(QaFrKw#S,F.i;t-xcP,laΙmf A?F{Fۍ I{cAZJ{r>OH 09~*vRɎɧDd0qف %ԏk*# O~o_yԡJb)B/}TQ>9J`Sug>;]3H͋FhDkɧDBSzwyZu"e|0o+8 &$G<^uPY*bc5PVݔl}W}MSEmb2`ՉSuWw).wO#B&S]S}cBV ey!'埗}֜}ڿDxU0I/O=O bO>Jvi.' i CQ\RK܋>{rG>lU!Z.eYϩEyb#|tS_U_}:jbY %"07cJ؅bV`ʆO#D7^_C[7X; wcGSmpdxbt1ؤ}fv `#7d_,NY$Vp8Zn!\o}$:\ףV&BF>*įGh: jX ?vMueG\=Da.!J%Tg7+7]l.U[5Y|gxy<,D Vv>~ovsJqޓ^kSK2Anٍ2G@'/RG{kqX6Dyҏ M)f[7YΒڸ>;F*W S9x$c cSS=]폛a=2ojzQ4°A7:712ltjh}16424U43=󤵡A E#a♡Y3RFnA#FD? ܔf;zM4'+6 閛1ߢ7Im@Bo)j 0W |4B-·tl\2L! 02(WOևkwUyx^$M.KbÎi5]w:ˌ!&@e 3urZCR8 t^A18 w6](9@ d(yl,?D;9 k`cҽU֟хu'5)]?zxjCG%x۔MJ?!i0Z11 q ?q`P^yzS^ %UqΊ Lp-Ù7OE ^G h\_]lUƟ@ˠE.ЋJY<ۋ+y΢+ӑ/FV0­z5nlKt{q5ww\[zUž JU樂ԁM`u)aIHjnkaROX "} m0{.5 b&kmZD]@>0TF^Ir@ˏԊa4 }{!4'|FL4'~Æ 3I&!sRs` -l`y0 WmǿXlvV5GqɼlFWk<hdeM6,1E^qڄ* *l轠dd_%ng JE"G]v^GuGm{,۽1VY՛zX7Jjcڀx]л f]K 蝙yz.[2AR!2-fTr'=ȍngſÿŻoUFs/QbB]4p ?80\Do]hOsws) ʂ!KLl] Ŋ M#0DmJ7Ś!F*PM?0{=͊ #WoR2=dn w[&1;A[tԂ@nN:uV͖}{MF+? G"7m$ABCk-<ОK;~^xD8v*~:fq6oqQڙNuzҮ5P.w1B#Mo|^]Zϛm`/[|ݻ^Z3]-7bN@ !).['on9m D'2fW@)fbv}6J 2+p.|j-wч@bަj͢vD<_фeknRp$M?+8()*ג0?;堑HLkx#1_G撥pZ@Hڇtw4'h ϖ qT/ SWL - 1@֏U6F5~9>sݒjMq^ n+>) s:wC匠-`_1kA/z]^Hj[Q+ 1ȗoZ)^6t޸I7!k`.j(Y4X 0y@RaFƓi:^Z蕂PԳx}gp6tc2c8dz/yW]|B_c,)eh/` X7ХDi,\ ]zX(L_'DxdTt4 &, Oh XCGk5"eK*O]+h벍~]:ID $%#Ix^H@#ugҬgk!T:``*.PUբ4i' "Co`t^d@qZtߡw[{Ǔ^ƪXSgξ-SIÉCE1)(bQ1yܞdǎj>=k[uyFuISm:N@XǢX!;+K}ӭAJ<r@5&j>wa|pj9\iJÅknyTVV5 ?y޿+8_;_& 4 OhCsOAT27up.N B#,XGe[Rsxx^&p9I|DKI zb]F k9 =ŜV6ߡW ӴxF6; T[doX&i @5ҫ4t) Љ4+\˻sn74 endstream endobj 62 0 obj 25600 endobj 59 0 obj << /Length 60 0 R /Type /XObject /Subtype /Image /Width 56 /Height 55 /Interpolate true /ColorSpace 7 0 R /SMask 97 0 R /BitsPerComponent 8 /Filter /FlateDecode >> stream x  Om( 0` 0` 0` 0` x$ endstream endobj 60 0 obj 63 endobj 51 0 obj << /Length 52 0 R /Type /XObject /Subtype /Image /Width 366 /Height 420 /Interpolate true /ColorSpace 7 0 R /SMask 99 0 R /BitsPerComponent 8 /Filter /FlateDecode >> stream x}XYW{YT+{ U *XQbWTt-`ǂU"(Ug%!$!e9ܹs{N"t*@WADE_x%:s%6! _IM `mm8OCb$7/D>///O7DŽd%'/oޣ;$t(eܵG9 ODqP)!/}w7ӽg/oOū>h/!y׼> ^#O0A?~>}B/^{`_O4kڴL aklef a$"@R5yc;vS}{ceUb/1'7{B`M Z4kzƃ$IxMHy=Fh ncďn"BH'''|?$u@#==@J$qi4m81="hS D 'WE;H>~l׾Õ{Yb۵$&NY~x7Wvtp6KZN,hOdffƈ{wZ:I': y/LpBCF EÁ7s<#zxmeRzBPh_;ע?wάEK C2XxB4=}0‘ #1wH,y|FY_OGRjBL/9rXT&̚5dsvRifwsm.Mm[#^Ri!WlHVb~^QGQ[6[;3Z1 B@U0F~ZW*ZzW~}E3ʓڰ(|*r,iI׷ÆKӽuZ?O 2 *A%3g~YcR ޵mdI*9`M[\k ^0^ `KYkӛ7nhSl.ZHB Ɯ2ȤQnMOjo?0qQF&RP HF;V&]upmnZF  qwqM2, ;hРiLB|Aȏ%&,>1s[ע6ڒPSJB@$B:ئMO_~\Q_%ZwcʧV^lvоaV2=5bՒ@}Dٳ5çܯ129oߞz ̘BD/:*`Csϟ?꾃5U@xtmZV.WQa\RKNƮ) 2Skmo*C> 1=p++2'~c8zH%!U uu6mڄ Ξ=eJjkIKMutG%p.iCuO*GGƓ073JJ;'n.Ns}OD\GG6hCpU~v_Gh.^$,)*>}bX/5CƘVo~-R\o0=@ ҝ峬EsIpv\B$1=~])r!I% pnVGŸ8;Y>w|d/KXY)(}|4&B$BbwafH8D @DQI H_|@j! ` P%%Z+No+'H}Ĉ"[l B)4iJpܼqYkS$ ajW}GdP$IB smz$_jF#05$!*K.-[M['5 B1@]v%JvZZ-Hp~!GbO]ѽ$P >p)~5lɗZ 0ǶfQ: ,.*e˖W|HczǍ/I ̥={%bph} /RŜAzV]{kשkJJJ~,ë;w߿Ϟ=_nРAڵetZVN79g(5fȜ2|xGww߿_~$̯߿;{ysg Z#_K@yGѣǠAX | ~w0|[r=I.3E `vnThQ.3˗/BFW,VD0f7Z]3IzAsexB={ݿ8h@b3M T5J<\Ζ߾}Y<'/UԼ`}o޼))#o^worrh t f۫[nUTI^a$5nG# f;z͛7mڴپ}<=ݹc&% DƐ3Hn/~D!>+P=`*$ -v3̬Q$ co4uo/Yg:ḏKFJISG90Q=P#@$DD׮]a$M,^qɮ޾$= .f֠^ӭwV6armܸ JWο8$Vhs3DoҜy4$LX(nHHٳgM6Ibc1~N?cԐo23qۍ?wvv ~*sssm`vtE%[ܷ\r"JY` ;bŊ= »wd^uӟRŊaWZj0#L4d6s*4(9e+W2K333M'HBa";5~1*Rv$A3_~ݿsvJU>;hhv>Z(()fd_.>tp_ N?X938/}LLLҥvM`&A@o p{50~Ĉ8'?ءCM0/>JTlӃBD_{a\q0! ];w_G)Vlkgk## ^4,QDCU,l\ɗ)d>}ɓ V~vܼ_?^*R|&$`>;9+"b5~>iMp, wV10~䴵hyiN:b RS  US!R*x$իV6(V F=&N٭O陛)-͆U|;`3OAWgOyNxO5w/6l7JCukIO帉 Lp!Xi(GnOo \ݺuCb H_++s389_PF 6l3(V%g=-[MMc+rLց\DX+YQiZQ &Y:uPa]Z9P0j;[Em{I 0spr{nɒ%MLL^z8*^z;ꢪbcc!^5TUΕcokCDDpJ66p 0P!\tsΰCYx޽;<֡¯b;w'OPfٲeU *$ .M"0x^Wº%Ӏ}?>>B? dTQ[cöCFY`)&0NyR1<?d|̱KX",@ʃZӄ.rLfX"-M{DYn:"ilȪ(*쉉r'/~^#M;*&~'Vi6GB-e&F [u4`#ziBbIUk7 m5qj %&STs<'3.tQp=[ '9FێAUxVUdOZj.Zo^cm{@`uNJgGCQrL6 j?}9|*"'JIH"Gnۢc8%< %[w'EzI'/o#d<}RŨ&%`I'%P"O& q %ol]+T2YΞŐ\||TڣH}B`@~A \kIel/"Eğuq'F"fmDD.\'ޡ!0lQ0k(ls]@PR[ѱg_+K1ڣG=CryhD6w[0u4_cf~M6K Oe6=c"ufm0UT(1! g_,.D Lva6"+Wl֠D(PF9ի g37lF<"c({`|1*+ZuL ~P&EǾN]jb=DN3)K  H)=wK&NI HYp&K%gR7iԐNMѣ@ H("`8nTCn='>\v|mA ح+ (!8tOgeظ):Յ['AȅTYbD8"kb J(? L;wh[<I߻wXj#戈 3A ?444U[1mk߾=ӧO}+[G%gΜiԨnd}Iϟ?L_Ս7eA_"Q|w DŽ~}R֮)-) Wi ͳJItK;-ڠEUhbs ޷o____-Z4x`֭[+V$&&&} ϖ ;cccX@l`{mڴb*, H_M  ۬Y3h=X,jD:t2G4aCt_?UˠOG=5jԀLXN>-*FP, Ƴ(]ԌX ?vX8 ZvUHHjOYĮ\Rn]<⠐$ɏ(Av[15]+Rґ8e~l۶-f+]23$!!HM޼~A~?nݺ!~[HD6[>C~"a 'm[W xӧOJCN<V e#Mѧw/ ok$ǥ_ٚk&$pӀ1A x9^n}֮];ljjC&oX}?)S`iҤIBpհdi "+z;09u(sk>w5kUݺ:s%KAWc!Ow A%((L[36F`ZsѢ:;t{;ddA<}VV<`V `o|z& q\\\8؏us<V9گ0PB;(r+F8:4hwCbhfD kռrlsvM;mu۩{/Y Q}`y8ݟuLn%wi(F`SsYjܰ3?< =EW3[[R pU*~x:VUiӠə 1r&Օd)WGQ5Vm޲!cR+dL.8GbXW5%&po*/<Ν5X޻vySM*$ɒ4Q9Kj@PkyAM&2bĈ4 JiaQnlccmrՍ@Uzju#$a..e2ds02xTfC3|k>8UNTP$ܥ멫}-)%hh$[ho/OQ`NٛÊ:TYL5I8u'ſ!u<U^,GXB G*^~%I6L*uO`( b^r6 )FW(_^-FAQ³t|v2FTKKTV`ǩ K/[AQ!.#Alu|PL!`9Mp$>{ z9`wB27c2r+EUVkVy3(h:|c]=a->u _G/^wu"KKk"V[;qŦtqaP@oHII{=x>f{xM.No>~8[ cwO!bfSE`KM֡gϚ C06bRɫwhXf∿]u^AuNBN +F 0ao>QI-R E]x5g`r\Dv's3FwHDxeʔ144sO\Ŋ3g:z "4/jPA1T=qlFmtS67 uM`ѨaÆ&L[פ5k"&$n%_Pp4 #\q[6u5=|;1|CHy*r# "pΝ#GwݯeNȋۑ1m4EkG=1#VB3)G)<ƛ(goӕ!$%h w+V$Ni BPLDvaf2'' IR +i1/`*!W*wM5D2$Fl݋ZuxCx{aC~}-(cJQ<09[L8 & Uk[r  n=={2ةӕYB~g-D 1$\BЮ5ƒX>byW=mllzx_NqjBg*1)8pp3ky "'٫(6=c0AY:8: ~Wz3_P C;n:x;o8[q;r=8=Z0L<"BEzow1k߂xuLy|&ߑjg j֩۱CK(%Q0fP FܒzԚm*+޶S/csɼl >pAxml֕q}:7W?v1qH٩{M0NйMǮ-vpAhت[6mGvs:wrL2D9zf4hǏA6>}Ts /`ݺ]:" ^"3#,C Y:}t"ERTbҴZfp >hiSbEi9<e+W~/_m"0e_IlK;9Pj:u b/M㽽S ZL4 CҲ3!!‘@1p*$wMfH pPUZiD QB ƍ4WL}pF'l! 0w2/\9r;2(pdCÒ###1A (.^=+0y[Dy!vZ\h**x#4)L@P{2Qt#$ׯ]-W/ҘӋ&Dbr#^nDkT Qc`LY$(Yr+b`oe{;W/_JUSvP (dJ>|x𐕑}TNH]HLQ4#W+筢Aa.#+82eLnZ<ʲ_JP ڰiQ}p!4IVLh,jK<~NeF e氐EKWHtqQ9q p3\J%3|0cVv$^`I.}}O ͵5:z!=4jt9Q4XŴkDplDVԍd8uƍ{wG]h8XkPwozԖ lذBhFzDsWHX_1z ^-ZqT5RL*PSNQQQ111+32QYTL,-Fw0m:zo`E KSla;Ĉ#HYW^5rӦMhw.w׭[Wc͜9,4V+>tpD#Ccȹ]EWn]$f<ۗϟ5|=zh'N0䑜8^ z@lXZ07,T zn5@:Դi#F.^Y&@KČ:T;ČBxN &iUU5h@uZV|KjRUelS!1 F/tSu4*6~irS ֮]&c&%hTz5S)wjYdpK{lϱIBNqd0zOa-96ѝOp4֒_A`d(s"ׯCCMe`F kט-Z3jMH%dT5GKKK(F|M֫_HtƕO*p6ѣGp]hf#Z'9M6}ǖ&k=zBOLZj.[ $G݋Y!oӦ(- v.}ū0T/ 4fBBPįN-7B+FrH wk-a?O8OԼ^dnnnh(4rY̻wאQU{Fy1,4XY=cccUӪU222޼y#w9x VEpm۶k׮UV'''l=㻜?~ȑ8hP.L^hs~VZ%8 ٹsdۄFH1 _J]BkbrR|uJk,R@Dѣuica,-[Vgƍ }6414$śsz(kFjj~TJ!|}ȐիWc#L !l, SdWT%m&ʔNxxVsҞ|?gAo2aIҭ ~^ XɖcU$˒_|rny80p&:%z5_W߿sD7hz "Z~AL"dߔ)S]‼dr1&MbJoǎq<ir ]3x37HxWicCݏ*|$Xzp븝;+G@J(1l0l`V,1G,0( {ӌ'Ob<)[4opsg H,fN`xk8vуͬFY;*Sθnr]Z3W\ݳ?/l(r S׫VYbZ%LZjBW$ }gggC)a EbD%J:rj߽r%Ibt,ԭSg]c?yI]!`ŵБqG:SU%!@N&Uu5x]`U3kޒƨ&u IzBx4#׍u4(@ȉ4 "tiMJfC]sDl%U905yo)K>`>BlteTVb Ӄ&-[38>t˗k'999Iӳ{hRj j?gAKӎm;v4¬kLi kQolȰ?xY)!^an/:\Ԡح[Bz˖L~9@ֳ, +篓* ,/PA7dDF 5mii5fcg"j9VG/0~oJGxS_ЩZaSV5`x`@RjuҊW[P j4Y9!F&cH5O,,u;Vr =11NϾQS@j'3"N/$"IwAE U0)[9rۢN=rJ/BhDt#GCC\}&hBNn=QNb%~i[۵h۷M%hH.ݟgeoիWIdJ@tm;vl޴{ů=|Ju#Y 4l߾g,9~j Jo^WRVH4T0,ȋaJ433;xv?d"yVqSAGnS`B'4b#j^p!oyYh?>UH N0ix[;z*?*Eh.Z$Ze}XlyZ$8S*F'Ŏ^B,XVy@Rqf:ɔYg;3(hޕ+WJ<_tn rbʦ4_}*X0apƊ3)+%{Nvvoǎ[H}G1dO 4&PK#IGZLعs… իעEv5k֬QFpu]vm۶)Ek/_N:ujŊghA444Ȩu >|xJmذa'OT" f#FeޣGaڶm[ +聋 -e׮]3fmbb"+d  %3f@@1ц̜9ˤfffP Q+NNNƍQZDt Y_P[ W=K~M|Q1055]K1>8+;=),,( 2%&CaAḚ%53ޛJ!\X۟زYC! f岟8q"s )L.1CWE}{ C˛l$I%\z=TahڳLձcǰI$I.ԢxS0Y`A>}Tn I@4U1Jg-Zu$\ejW@u=j ԰iY95$IJ:?VyHpj]m;˗kKnH IiYzCc)JQן$h)T9ŏP.sT$4F)be| -AEKf]ƍ:!@D R. IWb2*C[}jkg!~ڽɥD++++wV򎊍CsĞL2sjqYlYNqS>*$>rQ L-M&.e)3 es0BU&2j+$Ea!ðsCװso`UrJY*$|M@w d ~jii 22+$btEDTxܸqĉaU,I~2Zt'Lp߶m[l8億Ȑ={vؑXHHRtfc,abmmݲe˥K0`VE˒e+ƺXOy;q102AG} $_(v~G<<|URyJ\1$9ssj VG+~Fb*񜄨|@6E5OE;@.^7oJh`͛%KW\hA!p$D}Ͼ ^ opY7/v𷃧/8+w,VEBWmdTDJ*/@s+ $azW熭 Z _Aw6^e6Fף9e8KKC:AȚ}tsual;;88 1^ru `7u߷GY;` ?jWvE2qWl1nd?}(B@ "l !@N/9}=}gb}ٳ[tm[tJJ 6`-4 @D/:7;_u#z5%}j?$I1:@{vw`jR_8-QfK"pB|PX% 9N~<@WGŠ/I1@2}gM rN(A@SH?(zA9buaaa0\C-D`۶AA.:ujTl;N]i,. A MZ1]K)F? jPm:tnԴENy9X[ey! w4O_Hp1t2,΁SPl_oCH)> Ԕ{w>T-ݾ>|PmT0YoN!5FF4l2p𰸣G1w] (ܹ|(88XѼ^M 4_E.p cě|YAÆYXPskWm[jۦ 7p6~۶mRb5!qReʒ$_c` C_ڣ) ^nmm#/Xl𑣢lsȓKid$і)W e<=S8wuaSBnKa\ W !ڲysF~232J4u ̙3wTZIM{01ŭ,e(Y0(R2^)@}}slԨ4PM/:xPv999B[!̀ʖ?A_?~S{~LГipESRX*G BT' ^=G0+x9h{mXˑk]eDE͜7i⣇un} ,?> /pv.}vwn W0o#(Rhcߒ[1a- ψ[? cM&'tf`pj'%P [BӾI˶7m ݺtfgڶ`w޽ ֠A)))'NDǎkӞ#Q1KB\KzWJu;s&du5vSZ~qqqqHcC@hVfaCd~ԫErʕ+XvgE/@;'R›S&iӦ^ ;'&,txHQMztRwҵڲyp9WSz$Q{pS!U!UXiH8%g:v&=ܹU*UlڸX޴ԀJtZ%߼yӨF3Qbᓪ]\ߪ忓z&ufq$! dSW{RHBPVIDD~߯X}kH pfxD-a+tz&+v =0le'w/;WOVL;wlL41l$?߹OcC\ _7m]=<||pML2~pss6^,d#cHh#R]z6bp_3W9+慯 hQ0C@ jy$7n$gml۴jɾ L:٤Q9uqjp ؚSu]f4ʇVZ2~-)U+W^JjUAQ&Knݯ=f'wJ#}%KUntR*0)73{C/Hid\ > '/Q endstream endobj 52 0 obj 24231 endobj 99 0 obj << /Length 100 0 R /Type /XObject /Subtype /Image /Width 366 /Height 420 /ColorSpace /DeviceGray /Interpolate true /BitsPerComponent 8 /Filter /FlateDecode >> stream x흋v8D:#m FsvO#Zt:̿`_cGq I[&'pyy#92S¶ɁT)b{!T)b{!X9br}+ӭ-1OO6>.EwXI[ϝMy7!.vxD$L5}{~qy7!3ICz30ӤJCv%/iEh7bo"O ԠRV_p<-,RsR?k) Z}&򴨈I/8(501 Ġ{ukEDtN:?{#+En;gxd#1v"92IRJDpXߡuu[;\4_W{֩"6bt9-TE"7l(rU;wZDpPÍju\ڎc<ooD`mM՟[5^!caM7 7l^nDLa`y"Qmtyj(L6SlSFᦲ!XvHu]w8( 7Khhpܲ0z/VדV®zZL Y* Sey7ʥ1 J)pbd*TD.fUDVg*mF)`l|҅vFgjW^_»Z8{aӋqIV ]ʮAޭ(P}t%^SH5smV'+.`s*m+^V]G]b651ԥ~_ 9{6QV* YTbܲe׵T-qqw=CяgV}"%_^\ygÉK{l2 P[>#^GwU U´*mkn.`ƟT1rSVX>n`lF魚X!,߲n[R뷼Aj(%kxm((5~^;N!zZ ADTD Q `",b^=-l:@2p_&JYNաM6O%J{< YTkd]tWrO&qsAOphH+a8a,k:j>}Kʇ靂1iyr;iʘV{;tn#b/sZ3rG[n6 jmUI;g"E[c_I;U>h;uqAW/vU^ϚM]2mYrwb[OI-#{$ϳٟ}fxҞMvgyuW`2JݝY^y5Iws=spWt;);)[%kY-spe9īhz` _V]f߸DD* rzb mWN3UIͥ3҉za ce_ZV25nZ|T0Q̬H֖Ze5`_Niڝ6fz2]f jL-V+{SZqSaP.m-Q&SZm-&lR]Jf(jP_xbJE욙X D1:EKi.U,eQ M@?Ӥ1 endstream endobj 100 0 obj 3905 endobj 79 0 obj << /Length 80 0 R /Type /XObject /Subtype /Image /Width 214 /Height 100 /ColorSpace /DeviceGray /Interpolate true /BitsPerComponent 8 /Filter /FlateDecode >> stream xZ0tkI$%q&3(6?4EQTw}s^N6W  ;3O܇y/+7_{bȹ)/k yqfh 5oQs|Q>{SVZhU69[YRxX]`W0gimF+"ȶ\qb%6ҵw܆l1ը .~afi W:x7BVˡ ZCM` 0;@$ZAy6ι^jJS]։);|og8v }"Nk! Ffەc!"!=fhZJ.(jg{|J|a+?0̴EKBYs.GH<]~vmD6*$v*[ bSn'DQb r$j]$=o pP-ەt3[ [Ks J@$R3s;WKgYoVh/1[|/9Sju^25K??bGVsQqo5*bɻ=):2 Ra( Z D8TLq`ne)9x a\OiҜ!TKpl&b f|xs>̊B "4jUHQPH_/-$u\IF^&ހQ ĽF=bCG%QAi5&H.gNLyC/h7Vwwz~w[N.7Z(#u endstream endobj 80 0 obj 1920 endobj 90 0 obj << /Length 91 0 R /Type /XObject /Subtype /Image /Width 164 /Height 162 /ColorSpace /DeviceGray /Interpolate true /BitsPerComponent 8 /Filter /FlateDecode >> stream xЁ Pa 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0` 0`~VfB endstream endobj 91 0 obj 138 endobj 81 0 obj << /Length 82 0 R /Type /XObject /Subtype /Image /Width 165 /Height 120 /ColorSpace /DeviceGray /Interpolate true /BitsPerComponent 8 /Filter /FlateDecode >> stream x[ \UU?,n@FjڄQZUPMJYjM"FRf9I}Ri$ILMR1!W)jj(.=r}>{X~ܳν!DOHA4 vu}~O&<7:u@mcܚO7*ԩ1 jJsVzfajO-0`qyslLFG-C/'EuOv?>tsCk6Y-.nwkVquɂ~= T><0ګQ r7E_k`>jvl4 u+Qq}l)[lM7}4ln8[уRt sFc|ͣy'듉H(FS$Hyf׎{y@o0S|Jqqqׅ{q>՛Իu7\{_-iaÆE=r8P 92h#ENP(vaij\-sf*LBmHPnG>ム yC',uuth45#~ 0q[D,IB2w{Yɐbc{D_t{h'Ѧ<bΖÕ`WDPsj킔 ׊''?]fy7T[ei\v4nH;)ˍk2aR0<[L'%^#D@@V])FeUv#s.e79 bxJd7CA\BeBD3e ""Mp;%Dbڲ[.k05%TvB{\yQ^W-0)wkg@|y*(̕c"y\"1`_w:bWj&FSǨRAd ȏBd-Rdgy~ر QelcWM[\$>c^SA=Ͽ* wT%w2R-4ued DWW[f.%oᲃ|M1TlbUI{ ABfқEWwԕ>P>Hg}Vɢ5IMrbC85L( {DIv@oRNTH`q yox9 Em[MMNMMU}~|/m3;BPT_G^IyP+OSo͙[;J48A|~k0Aj+ރk4{xCUA%Y~Elӱcʄ=>ȪXm^̬oJ StwgK))NHduL)ivnjop6@rsAVzI OC&,5)~$0O)?4Ij[Gu=kGeOqa%YD\,py$k2g?2k 1y3H=R(6RI\Zd[ =[3fΜs&W3cBΖa4yJ K/ Vþfh1 (57;,|QۊhY)|c1s'x.VB T$K3i=F{\y!,|ɿZ4*5iSQJ.ʣJt-a)q鸗(&U@RJY`Uڗ "Upi{%\1?Φއn2_O܆+ՁU)m*$NX] 0kcnn &LK>s5F1hܐ?QV HHFBG^K(sEr)*MI|IחQ(D5@/h,}';7Rkk5 2(9Q@5{Lk!'4qeF_i\@J;tnb ͭN,,,V뙔xmvDDZapI¤,-Y{3^!(yE@d7c4Wϛ7vzF 8qT3|eR몢ڍԬu=C9jT@,𼆅#Lb\XNӗtBk:kOiJ.PmrrJUoEat>(1LJoC*V"(m&5Xqmҽ{Im w"_M!4dG10ՖP8Ǚ8,fb!ϩkϓ$Q+Igóz&phXّd|ɦ 6Ἣz@2*lΖa*mQ|l SD5P)Omxo5h}{dfNe ާ x]RXaŨZr&1lvz q 2[|%fk nmKX.zI&{!=^iRtPe3KSɐ6lw*TxێHI( ׎H ߡ >o]8-fq.aYtD>U@b.lŦJ+>-рf@᪀aU3ʓ\f81f[~Ix-*4ͼd"mݛI=ӍleF%zq7cBGEEE-lxTi"K[P N%Q\)rv➯T[%kS{ylk3Lou)pNχ7TxG9SJ-Fy+6TkO#x!ytnƛ#ʩATu#CjB.+~q3 %>QQʇz0%RX# 7,'ՕỈ^G {z_[? ȬM1Rީگpm yPaGeas 彔 ~/EI{ )Muà"SOgh"Vi>.><8dX l rR9k֬p\dԊu(xTJ: 222r Nr>T@M:~騾j=/}E#ݯ C'naVx n¡]㓓^{Q}6M&de-ԜZ$iݞ);GjKXp/OP-|龂F)#o Ii 4وM1:pVi|Sn!:oS< *=JL\ OZ)3i;i٧[-V)l{ݺp8n|vS751k]]"7W__XseIipքP>P>I'հhʂip݇⪕qM/ɤbU*2rrr1D&|gr 3KQ2HkL'ȸKc ؊]qԩT O J)o5bRqJnX%2Jlq]BB~ID*T:9"O"H]PyH?6iP˘&=z&z_785/qݹ3/l1b"fCCr׸.}|sp"Z=If NƒOrӘВ}B_g견p)^oGOO2%)߯4ʳ*C Rm?_Lw\64]?u˪"1ĒgyVWSM;,JlW R/15i"tz!jpi7R||i(УI#Xͮ9߈_k5F)|5طOKV }4o&g2p<67a+y 0Cvw ̧V{V ԗN$~"v]F( R֥*|aKss;^oa)\?O7?8,1mvlwi>nÄ) -9b|\kWT̃oS+7*80 Jp[NK^_w?/X]'fj)r 9*31? endstream endobj 82 0 obj 5087 endobj 92 0 obj << /Length 93 0 R /Type /XObject /Subtype /Image /Width 226 /Height 121 /ColorSpace /DeviceGray /Interpolate true /BitsPerComponent 8 /Filter /FlateDecode >> stream xܱk1bU " Nu..(tvpk\g'*H; ]^Ki޽}/\U2-2>)Bܽ^]E3E|OےT pQ *$A^ (Or ő7 b <BQ)"(`q",@daB C" -< %2BK< k?+ \Tqr9uA(NnؤJ|ܽH5EUTI> -P FW÷:=v7.fРMz@.Y8#R`a ~WD }U+LXHTaRH!A(Sةl#!=("gbx¬2H8af왇)$0;q_b l" /D`/q^C2z $V@6P,/UaD ,&O<" Nq0Jtq0Bt%8"zš8}`YaE`a"t!P.3{L?kuw-ERp {X ,C(M:ggQepSJox_] N7SVqkEoemRF!Z`@,,ܹ2sXVsI̎C} P8D liK +(D"0$Z`b ńlAM K 5y1􈥄<RoYL"7.&xG!vk ! g̀[ybPϖG4b/tHL V+sp܆ "('R>" )&Ҁ."*L@XaH D:X#26D[y@pKdхS"/l>* s.F$\s{asA{m9[\WR!l(X@hzQ(oQ Dx~}#d]hzws\h͠A"B%" %^d{!n^΀Cp +9DTq|Ќ *<.Y> stream xЁ ]Pa 0` 0` 0` 0` 0` 0` 0` 0` 0``h endstream endobj 96 0 obj 110 endobj 97 0 obj << /Length 98 0 R /Type /XObject /Subtype /Image /Width 56 /Height 55 /ColorSpace /DeviceGray /Interpolate true /BitsPerComponent 8 /Filter /FlateDecode >> stream xݖi{h [պ֥kGQTK{sk V$y-ƀ~bXf?Ej]7fZ)aw8IE:vZ6t{)?0 M)tUIl`#`< ҔHb@1!>ҙL>-$cs;60ᢘP$ʏZXg.Ficn_0HʵVϵr.>MooAg#Cx<n^ʦ",&1BJZu0Rf|F5/Fx)xiwhXoGJ[|:1Heŧ@֛nvzNN QpXovwm :\Il=P-P{o EjU21Bu9Kdǯ}| 8^B"N{wG'O7*wjXœ9 sOMo_ b|fF/,,8#Pp )Rs0L4IbG'z9k7Qp, _8HXnCZqku* ܿgNr|͟x~ s~~Vd*YrzyLX/'CFON(6$Ť`>볠i#}C+p"frj80_ϴشn~e+-Iݝ>(c& wFP|0_Blo7|2h|8cBj̳̳:ڵf< tM8?I* \"Z[OTbJL=W}3)l<CiԊ$r?`6\\|(UXT-=1.@]0zi |\+s!fi/28#FT;ÆODci k^] ߱?d\ 5}p8]>i@4q9׵&%}պ{ ljo?G3 endstream endobj 98 0 obj 1100 endobj 87 0 obj << /Length 88 0 R /Type /XObject /Subtype /Image /Width 55 /Height 55 /ColorSpace /DeviceGray /Interpolate true /BitsPerComponent 8 /Filter /FlateDecode >> stream xi{Z Q\AA.{AQQ́N;}_IN__02'p889~ Z]FF.s藊@9^ò,R҅gΆ7Fy.d}+QM1HTt&JJb4Q [( D)/j* $D^ϠMQL(&e cQnBF6<$(6" r2O&$L>Nql?Χc)ɁN$rr;zcfZaQ#PgV\nk^>7!BOT}ۛv~h:E>Yl&sgqk9$ s5ePm{{;{Cvj91DN哥\! $@t3G>Azg^Q3wkmԲBB<bc0׷ nB"L fTy"OHN%B25e|7bT3Q"8(,rti`iG`aA1ԟ>g<ɩPP") |f؛_Ɩ  dw@5rNɉIHɱL6"VI|nwVDbJr AĶ|(Ja/y:Jdܬɍ6B ?Ԥr)H 8p<_*SRGJ=A%J:p4Uwnԥە67JIбor!1+Sme\ tЪd $R̖00̠5{4at:9xnI(1ERf^KKK ޶|2\g\˅::JN0NKd2+`:NFJVā"MqRz=zrBHص8br^W}q8tlt&f ۺM?kOxh&XLEH(yKc`*Д E@xً -AנڟD;rYK"^߼o~3 endstream endobj 88 0 obj 1179 endobj 85 0 obj << /Length 86 0 R /Type /XObject /Subtype /Image /Width 56 /Height 55 /ColorSpace /DeviceGray /Interpolate true /BitsPerComponent 8 /Filter /FlateDecode >> stream xݖrX \qLoӜYCC ]0ItWUC~f/Eh4/f2 @^( H1DLf 6ϱV-2E|>v9+"ԜY{qV3Īap4bAʦ㑀( 03Fo8ʵf[j1ݼx "E0sŔTmvt6v< IJfo4[fɠ]an m@F ɹ\3[e?n#/ƽF!.hd;G8\;^wt>OA٬f1pDqfhWVV9Ϊ~K=;y6hA'CojXw8Un=P'kFa!;bRs_WPχj)B;HLܥ+Z9O Ű!EmHLFh;7vi :I#,wgIx>nz"e5q|yB:E/y"hRQ߮O83 Q5a"m·WI$GX=yA*w& ✏ ?6^9҆rYpg(Q70PG >ԣ7%Q9Tg=(u0?8TP/LкzA!p!*3EtJM#!T;m( r3by`b r.%QqhƸbkWϧv5V3 K t=t aZ>wX2}brvN!Ɛ y4q_0E1׭ಳ4Ec9\n34$(aYc+MWJW_W-&K,08< Apy]Lm_[ 4l=B13 endstream endobj 86 0 obj 1179 endobj 83 0 obj << /Length 84 0 R /Type /XObject /Subtype /Image /Width 55 /Height 55 /ColorSpace /DeviceGray /Interpolate true /BitsPerComponent 8 /Filter /FlateDecode >> stream xvHm@9 ƀ 2lUch=[`VuWu?< '1w$atzH`u! 63fD :H~ϡ;Lf 6 fhHM<^?{N;oaLF d NO@Jx""b,fJoY E㩌/ y9=5D|hVZʥK`i=hY1.T`87YɿB6B~W61/br|(eaL`mH2WS\כzԦ~*'ER6"n1wZow~mS%B.|eh3ktp=SyX9]QF>7TʯQͯ_(~>S|"^A'ekomo&j &#,Bn]M b~||2М;t':"zFw).Ԍf+t bWKWF=<}%bϷs;VA3'ΓP=,*cm~a1V!1'L.!vk_"|)u&0:5:Sbs;T۰?gd㺒n9[흚u{e.W[96VJ). KLV w'~#ޓMo4SMySINjx867@.;5  y(Zn;uᰇZTßm-=(gqbي|lV:PoYr*rPsrUϗ .fMJ6tr7G91!WZ:_19SGor6rd&QWJ4QgSu2)b:r pz DNp\p ^]//A8;ng9fwx?KJl6r!}N!ԥEbp gwR5#rr6JHm2?:efy G%IzAα4G>WoS>gsynCX8??)X9^(04ÁT\K+kWk`\ 9p݋Grtxr3 endstream endobj 84 0 obj 1173 endobj 101 0 obj << /Length 102 0 R /N 3 /Alternate /DeviceRGB /Filter /FlateDecode >> stream xgTSIF Az E@B !!Y\ "]i EED .DE彁%z9sw>3w?[L  + '$q#8di󣄿whݴO$X@Ht [B$;Ya.(-HaE!R NN lLt/x2)L4#Ku~~A4 s'3PssR]!ݟtfp|~a X7[RKҽá3,Ks 'm^Aߵ.\J-9tIL~wM-r4pf%š%,P@ c`l#p^p R\`9X փbP A=8 6 ΃KC0FK0>ipB6dA3CP$%CiC P)TUC74t Bahz }Q0V5aC v8^9p>\oZ !%<(AYQpT"*%DE*QfTu5zƢh:BǠYZt]nEoo Fcq004rL1ss ss3biX#6MǮ–a`[]Avépp+>Ixm-> FY ~ G0  lJ!B:a0M'݉tzbxD"\HH#9UuMko`@0p6452423hfHňaodȘbic\k|klad6u0֘^7xf{1.|Zd o<&aKeeek+}DmVV߬3Y?Q )ykkj˲eG [gn̞c!aCWG'Gc㸓SnΊeΗ]0.>.\:]>:w-í3y=={ yx2=k=zy{yx{~c#93ƷW_$@7 -)`"!pU`W&($h[]&h`L; !DT< 5 vaa-4X_GED(bQ͢g6#{Qˢ>DDo~c#鎕Mm+_-A-ОKM<8ţIIIw-YRK,]\v"ܘάeN0RvL|Y;Y/^ 8ǝSKuO-O}架=mɭyo҃Oegeded᳒Nlك3A`(5gG΄0DxXs'6$ȫ9}DIOQOB+['ڸmC 탧OwwuNΚ3Jg%-:;s.d#˺^pgQOŐ/\{+WN_uvZkCߩ?8zz@7bїӯ{k'o"~b۲wۿ|!TGՏ?~<6 KWB=ɚ0Y/Bpj*o$ a9<yz%~7yxG) H7@`;;iGID";Mp|Lzʙh$ԧ%ԑ?~5 endstream endobj 102 0 obj 2747 endobj 89 0 obj [ /ICCBased 101 0 R ] endobj 103 0 obj << /Length 104 0 R /N 3 /Alternate /DeviceRGB /Filter /FlateDecode >> stream xgTSIF Az E@B !!Y\ "]i EED .DE彁%z9sw>3w?[L  + '$q#8di󣄿whݴO$X@Ht [B$;Ya.(-HaE!R NN lLt/x2)L4#Ku~~A4 s'3PssR]!ݟtfp|~a X7[RKҽá3,Ks 'm^Aߵ.\J-9tIL~wM-r4pf%š%,P@ c`l#p^p R\`9X փbP A=8 6 ΃KC0FK0>ipB6dA3CP$%CiC P)TUC74t Bahz }Q0V5aC v8^9p>\oZ !%<(AYQpT"*%DE*QfTu5zƢh:BǠYZt]nEoo Fcq004rL1ss ss3biX#6MǮ–a`[]Avépp+>Ixm-> FY ~ G0  lJ!B:a0M'݉tzbxD"\HH#9UuMko`@0p6452423hfHňaodȘbic\k|klad6u0֘^7xf{1.|Zd o<&aKeeek+}DmVV߬3Y?Q )ykkj˲eG [gn̞c!aCWG'Gc㸓SnΊeΗ]0.>.\:]>:w-í3y=={ yx2=k=zy{yx{~c#93ƷW_$@7 -)`"!pU`W&($h[]&h`L; !DT< 5 vaa-4X_GED(bQ͢g6#{Qˢ>DDo~c#鎕Mm+_-A-ОKM<8ţIIIw-YRK,]\v"ܘάeN0RvL|Y;Y/^ 8ǝSKuO-O}架=mɭyo҃Oegeded᳒Nlك3A`(5gG΄0DxXs'6$ȫ9}DIOQOB+['ڸmC 탧OwwuNΚ3Jg%-:;s.d#˺^pgQOŐ/\{+WN_uvZkCߩ?8zz@7bїӯ{k'o"~b۲wۿ|!TGՏ?~<6 KWB=ɚ0Y/Bpj*o$ a9<yz%~7yxG) H7@`;;iGID";Mp|Lzʙh$ԧ%ԑ?~5 endstream endobj 104 0 obj 2747 endobj 94 0 obj [ /ICCBased 103 0 R ] endobj 106 0 obj << /Length 107 0 R /Filter /FlateDecode >> stream xˎeuy>řh`/C- XbmʔPMIM#xWs2(5\;bźlz/6i{7tn~o7mf7s<|mwz6@?{כNޟ6e+:l_/G{_?w]vwlӏ=ϧ'n/}ߒa/ߝoq~nvs6u_ <׭ݿeȯ`qzB|8n`?v8Ϩy'vx_hC?6S뷛^Nr',=Q|>n˛L|~6ôhFuHܱ\n{!;r'F e.e:ST#ދFx|=]߄p?Gy_'7i#_d }yn|9/۴:tڟ2%&S..DHv 7x˛>iQ*u-^-z#B\.Oi۽a#qsّ\1-t^_$e6Y߾?^O9mgagyo|k qbqlzs?9??=_~o|do_6ǂ?f?ͷoyy|z8ou?nns66?mm6?s_X=u8ܲ T ߾_#_ݯw#n&wns1)ñ/o7O'xd s^o3w vk0n;zx]7lC-_X9nW ^HCBԻoMT/b&;F۾5M?~O?o6 iqO;۞^Eyfrp 6n _O7&lsey8y uVN}C~qy/~ {󞣿Pm]Z'TOWI^4 z R@_.SRv~L)Ufis^WℶGwK,ZxW-έwea?/6{m'έDQkK~lܠP{l_p3`QkiO(=`/O;=!HÍ>{5ζP<څ6fug<4[~e'/\Sй/O=4on?o$bz+>͂Sݾ9~skŗwP&y{(]n{˃ޞ}-U/RQɍ~>V}w{wG+1lwGE.ݨfv03yӆ6/,hF9~'=-RzI= 8sUgl:]ϝ+EqO@'cM^ھvۡaܿwbؗ̈ [q~߶OΧGnlS;Uy{C7oM((Lċ焭_a6wO}GC=z\(=_[~#YTb# '^}zVӭ;Ǟ?TnWi:[%Q Q[x$A w>Ӛ9 _sJ۫Dsz$tFVc2WZ|7 vAĺL`{ ϝq/Xώ{n/R{dzʻ=#Û|!|t]C|U yJ7w6wW7{&F_oÿW_$h{F3yYU&Cï\qTkXx9 ʗ/v֞/ef잹:<〯G* AH- 1&TG0FwTCH;27a6ODX0˗;Mk%ߟ7 [#t~=(<츗lG+w =B-'_Rb >gU c@ŲIO~9Hs⯛ÁS (|w0Ű;V5R?4˿iCy}k͸Y.wm<{=.R~׹LM4ΌdBN˼+ v:{mwۗ_6ips罢gyjZ:y qEd˝z?eѼ?L4JgF`NBm.ݸ@]Ʉʼ,m1:>rkNer{u<6V$,]Bfs.^pz~=f5wXo!sW1$]iMAuV=fNi[Lp0.Viy`x{V> Ua"y+u9a|FGPgN<353|HtíW T3v綻U`ʫ\|:ȕݏ?\-BHr85q5qcU./oG{A( vs=r6r"hrv壮BDv*C= O $tR+WU!ʵyP`0E<y/Zcf#f*$\ۅI^5b#ޒx䄳ț %R 6KjA 3?DPkຸ8MUmT;!zNOǝf-:s~L("3^pcãXŻ ͬAحX{ U[9I>S3Sλm\ncx^ 484΄&1r6(3^3f"p>2/Μ0r#ձ{:{Jz #՞ݮI@XPgmAy/Vcݕr.[䬡vd?_THz]_U,t?x'8t&d-K->_z6,2 7"\pև[3 '|xhح ed;|aA.{L@@D,hV~e!*Nχ1dEbn>6V 33*ae%~ \^nir05[iZ(;nKck"HMql_5(7ޅBE!H06eU=ɑo.aw3QC^35E *`є/yZnЪ+ uI7AN"GvcBʚHFV77Fo# 86[1W"3R&8ɕx q8h4.Y*{"R]x72A!Y#UCT5Dsxޒm=<@NNuLY}=w#絵g ɋ$P, )1nI ` M 2VMأ AZ^x#R<;#O5=?m|R/ r ;đ#'U14z AZ(2{ !ZDIp;NDSHg]s ńI?qauDTj y@C pw -n6Š_$=tXω"rUt6qʬ(2&1/C-b;ϷOd5 g+EχX"qJ6* Ɠ.)Չ p:r55MACr(%6k^-fx +%HB5U3b⇑z~uY+q8sECӉt-9K `M-dĢ(Kl’)=Gy$>Z@3փIGՠCMGiL2e[(|Wc9y`Tֈ˶pwS,j oC僷&Xv"@[dBQ%g,cHa]tb Y({HyCK4\e*膍nyYK' iBm%͝$ytƀ Nq(AXe(m.9EYf JnԤ-b/g93j΅  NG m%Z4P]Mn/j=RiODm K*@]%I bą+38:1O܌.l0 GQ$i9mKӋ*|uZ7AA& µl7 50b`R+S%_ݴŰ,92Tqq'{cZM7j[; n/H8$Ya?{+rLxe=+wIT`&HӃp#6C `a7;.CdŗsxE0qq״BI%mU˼0;yc(U܃֡R{Kkf{7,063n5l\@h<":kZQ2Ķ q!KX "DR. 02ƫ˙qkV)eLzK N[$rB²%lpt8o09i|r ֌@Jl!E|s("l^-ɉ0/sj д$J9/x3Cu!C \ٹs)2[# MN,*!ǠO :x3.0uRu]ScpOqt#ꥍtV. $tJ̃I\q U Rgi8S(zI,c`yHybK=E;=:΋9PWf(3WGY!7y}1b|K~$'SEFOCRh,ru { S"^v*HH}N8#Ez(2UA.[@9y3(FV$p-"':($*r/QJ+˱5'$m=d3iyk#ig|i,^RF!{-g!)3GwG? R&ZrFcCeӹVaߵIS/)s;$+i\k#GJ+*^hLN.hqwό,s UF$R?jVQn(0Dv';\V^FZ$#S<܀p}o)I.͡0Hj[<ZE;NI]Y<iZ.))\;7/EϻCMtg`TKuGNpFE^et2! " }.\`j# :k%1'+fY^սV&:{Fa:N]`UO+Z)XI©KNxNSq2`}l= kG ܘ)U;jxc?(ҍn 攎H#?F1"д\ahbz20A!PaX. "RsFE 2GC VQX0 ):&QtŁjN.ŃHrЈ^ܤ. f˜=Gg<50i,-Z 4cJ3)vC9 ]TG@mMZS21aswWg.*;|3!l"eXS.Udֈl5a#-Z- ƻ?wc%e e$4Oڻ RLON(`Q@L't=llnɰBoꥋ ЬC۵YU "Nf* ̈́ڪčM?c{}Hqa⼱qlw7,LC8[KB'LL˳yĔ 3%x{5o0^.o&X$Ƴ{Dӈ'[bь x!>"c9%!8"qZ8N)Qc8@D7m4|k(ktMR=|jЍV]40Fhe̬ os>tzſr\Pe6E͂jD5#Sf!9"YH$؛`*`qj!~.0%n!%iwπ_Vp'Sƨ Di-JZ xaLG ŪMqH2M2 .`j#״fpaA(;A(3I="y<2)@Jqt3Vvs@<'P "t8*ǑDT^Cz'3Q^ZVVDU PLWn|i ^-(Zr<>Ȗ$D^_(@>BĨ"jM6[7}6PO>e&aoQ)ZBM 3 fw`l|0s0azn}ڝkE32R΂Sq1hPmO*a1Xn+YZ;@2ɉb=m0tm/0&CMk"xoi 79:`n hs*^) U#!( ZAa_r.5ĚPߊkFB-5{M~o1b`K;zZX(z uyI,Jq %TcJG~W nw;M*c3Q3G ˉ0R',mݤy `P)3,V́]=1xuWquV)1D'vBNhf9YR,B@Xr27.p?ԹA V+!N Q. Rm a׳RkMR%|7yTL1.M5O Ʒo`+)Z>:٭0m 3W$>TV}³숍{T}[;' ?[5{[>w' V!fJǒ2{Kɘ{"=]X+r>>^:&=,5چ`e̙ܬe䣗ZfU 6_eu~ s1PV%6#Zd  IoX2ȣIbVFE @2C *J-1eH<`2_zᣲHAL]MV1ADz;1b6`buSqSUYgED)qJ] r]qlN(k;sw^lHoXΫ+b&C k儣\aʒ9%f݃}_+C2u 3ձ(T$Y"@{)Fd2UcYh9i/Stwwr 4PWEaRUѫ*u=!!QnXW:.UV1ULbcSXcm[;إ]")ո' 2/>j.'LŹ4^l}w8yti0ZŢb/0MlĊ湚Y`IY^I,YO(н @< U@XK~4_\*(c`f#|ʫBsUQ2eaBa 325l&TrEZ>f|N(Smړ F\ph?em(A+{vrk4_xw dxm(@g*)#zbJ~ Ǡ Kr@{L57 g y>[Yeq/mqKPl0%v-b~-@ⴌIE;9,0gI#+b)N*ՀȈ _0KF#jMfp xn.K~F=V%RA}cR >uzFhg|cůU jMs$UY+b1)vW"ǺPWګZ`j$ozkCu #0<Ҫ@VmWrBpP8R gju0 &\\z·xq,|x]-F4 <^L6R;NK'-4/D7vitXA ӂ<3 O0&&P@,d0; d7JPZw#*^dqx?|YdLKaS{3B&bLGB-nc]7b 92].~q;jN]͛Up3_AoN?T_0<y<xɗh H+0rƬTwˉ=+(bQZ1m.ej8(r!P5Q3S,`#)@&qRF?0Rd&u39ܑ1%pkXX@*P8ԅ ƅ :yϑ"0F`UakiOaUm]gM]u9GV*Dk+H 1ܹYΥ}کx}, @TTyoiײ}KaT|Zh`CfZ Da6N$Fyf۴nY՗AX@u˳pS bܥP%Tp:[f~[8([ LJge&q@BCp`&?w:OPDAsV^|";/Qw܁[^?8֊d(O.kA3]av"KYZ_Ę^TF#_333hE CqeAc崥 B!ۜNj?@ ?.d L;U+f]/7@pjc#UDYKEi)w"HH=?k/ @r$K%s;8 f^t~]^V|e38<S-h:+U Ǿ=1K!,IS;kl[m2 1b o!?ه̀zNYN =.dKCyAVM.fr&0Rl.执n°qAp xp8VvA^%X)ɞ,H¶p- endstream endobj 107 0 obj 13999 endobj 105 0 obj << /Type /Page /Parent 3 0 R /Resources 108 0 R /Contents 106 0 R /MediaBox [0 0 842 595] >> endobj 108 0 obj << /ProcSet [ /PDF /Text /ImageB /ImageC /ImageI ] /ColorSpace << /Cs1 7 0 R /Cs2 8 0 R >> /ExtGState << /Gs5 22 0 R /Gs1 23 0 R /Gs4 24 0 R /Gs2 25 0 R /Gs3 26 0 R /Gs7 27 0 R /Gs6 28 0 R /Gs8 29 0 R >> /Font << /TT1 9 0 R /TT2 20 0 R >> /XObject << /Im22 113 0 R /Im21 111 0 R /Im25 119 0 R /Im23 115 0 R /Im24 117 0 R /Im20 109 0 R /Im26 121 0 R >> >> endobj 113 0 obj << /Length 114 0 R /Type /XObject /Subtype /Image /Width 269 /Height 269 /Interpolate true /ColorSpace 8 0 R /Intent /Perceptual /BitsPerComponent 8 /Filter /DCTDecode >> stream JFIFC     C    " }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?((((((((((((((((((((((Z7.3(Z<=>]Wzk m$7Iq,YȿW 2\i^?|+jv~bͤMg&3H8yϡFq_?ٛi}/IMbJrlovu/xS~a_H$,:pS#0^19'0eBW esm_+ҿf?8 .ռe~>.KKVqYJ.f#tlסـ9ٛkYC~ן΍Ju4w A>/{J~Ж6T{C+8iTHɌB2_g1Ӟ_'|i7%: ( ( ( ( ( ( ( )~b ?_%;OᏌ2xzWeb 'ۤ 0 FZ?sn-%dئ+iX*~hqO/6a?iH&ҟMVacLMeRT@q@Hf ?TmB|{wMKIkڬ6p /3*|cNɟGrM\l|aDX7՜ʶoAsvA>:ĝG_ nT,7X.:;yDdޕQ@'۷4a?j?x#Yݷ_C2׫ q/ﴫu=2[{yVK{d*񺜆R9A~s's;6^ ][P/< q+N@z?;[W iۛ%ѯ,>}H\%"&ūt dDVb 0lL 䱈9 +/O^ Znɴ#XS(((((,4|>bnowt4"]H+)PG W1ysuwu-I43$Y$I'Q96I+*A;WW ?o_$׼xoڇ<+b\A"nL!E'!;P}E$yOw4-Đny.%_25`.(  ( ( ( ( ( ( ( (EvgϏ'|W8!Fۜ:wb?h2_M@|DciMb[% @}8c~Rm;؆4_zQ ^^_~hI>6[_q|+{u4[h\ƐG#hX \?ҼS~NP C~b\j?y]T7WS$!G`UGtQEQEQEQEWYDdw^)+z 1(E%U P(f3n3ws4q_ĝmG?_h5y~Ա_\Maȹ$~br__g#^q/ᮤm.ei\s~fA(!+?|yxVN[=]:)#]i%_/ ?k5Oڛ ?zm܃m|+p9o8 y$@9#Ӡ(((((D?g/ןfOxLuOIԵ-mVǙ!UfN$Oٻ #]i~߶gf}/a|)aRPNGY;ſ޿O[W௄^-\e-2f^YGfO!:k @ K xK񶅬>&X&Id# =8'-yZ6>}NuFҮ/$Hak]:t-0fg6Li@?3k>"_l׼Y]f"KYI۹'5EQEQEQEQEQEr+f,8k>9!ֵInWѥ".kKTSxnd9 qfk K%=>;keB)럜q@TQEQEQEQEQEQEQEk"-{Ay>$mk; lz֟)>|m2 Tqh{x'yBm>"xg]LvĶm:3؀25*_I |%g7⏈4tpOޞgpK55uD_ | 5$ᇏmt|i#ӯc[x{^ /4i]G |; twtr3햮qs1@;)F*ç7aਿ~ɣIgӯ[8 B9k(((((+0!<~? MjT񦏧͸aIrg s,p`m_'oah-7k+Ix8*Z#(( ( ( ( ( ( ( \:BkjeK{[T(VQSq61Oys]\ʱGm$W5S_-o;I6^9 6㋜~}h# 5P~W2En۲*p?}9w?s~ɿRmK}Mŝ6y;?aGJ!?<(π><(VYY]DI"bs:.kG |GK➎|UϦkmǛU=A# MLKw/m% ,`| 5EQEQEQEQEIggw]Gaam$" 0Ybp$w_?[/ۥhZw0ArGUc"k]拥o@ck(B( v_7h|[ \kJ6=p Fe^q!ۓW钍QEQEQEQEQEQEQE_'<%Nk=SOF$p_o/5 ~ேzEaA;c6*(W'=k梀? F]uworB?O_SxTq#yXdwq .>o,-)'`OZ+*/Sq3flu?̺Ss^e$e}:0dc48?O[ PHxO}j8[:ͮpґE=(V5}| -O4pֳ֝1R{iZ' 8*/b~ZO;VKi]" knMTDYۜ(f/ f{_>ˋB&dpOU((o?߳C"=yM?hq)ls-w40gP$ 6\hWkl^wYD[ۼ1-bN ʟMy>1|IOe]T2[&+`>,q@>((((((((((((򥢀4LoZJ #4r H ^c q'ʊ1?#_;($Lt^ %?b<~'j?gqO_P/[O񆵧n$1ծv)lC~Xi0zf kA#UP0U(@(((((((((( + CJ}o>6ش?mfƛ$S"5m87O<+u㯊=7ǾT5(mHGɯɯ7~ <>:+hJ`[lOgۿ YcG!j6Ov#2y~TBF 73ks@V}4_|NiU|:/B|ңbB8<QX~|~'|g \ ,רּZ Fr 7\נc?;~~/]gCաS,)2>}` ˑ> z,V# 9~$|+< ɶYBz\j_~kTa$w.3#R!'FASק?MKĿuR蜂ۉh9 ?c E|>O/m^k Z ٴlxHǞ08=+g_źw|[[#m6顸2KXA#g_jWA%4yMe8D0 /@,g$EV?{ߊ~!|;NhZ͌wN,׶.9ta$s[QEQEQEQEQER;Rrik*'G5gGkuuJʂYg`۵|y??fNW,YFd<)dËɣ3|a*]++3~#x?NZ\jZx7R<9,OrIڃ_>?d,|UI}\0,DžU *\mQEQE'  5?Vks:i#nbQ_`6"?n|hOueY̽czk+<a:'>; \k~n#Ox&kD /acO_| hOX5vek&>x'$*Fj9HSg]緭~~qӆ|qX|EgN+ 9οwCqS>[O:x40XȼA+,r(vYvv.Y@$Y噏$QEQE (7 'Ľ?qj|I$wNZO J~nY[|8d\0; A|SZPu+Xl/%Eq dpT" _ov]o%ǿ+]Y=mJ촓q!(F?{4PEPEPEPEP3_GiX~ľ oֱˮ[Fc^;?[Qp򎹯t~ּ t=&Pi$qCHzI=M5/ikkPTlKs;Q]G6((((=a~<'~;G \k>֮,AXpld?C?gíxwZ&e~e~VSs_q?w?"7꺤u,ç*9+='O2hOxKA͉F\eJ$*J"(qW$K+36Y@ ${EQEQEQEW]_O=|+|EvU/# 8me r4PaҾf/_ u8ox~ FܡS# K z~.~kCuyo& ѫ¿hl7[`{ WVr[I UR _ߴ[W3:C(y66;n^NR2r9,4QEQEQEQEQEQEQEQEQEQEQ׊O ਿܧ%4o#smN$t`M~7oƹM0X?÷̤,G[*<9F!~eR.=5mirwMu)P,^@Q@Q@Q@Q@5YkSo7 ~ğ ˉ[|6h4YLGc ri3?]_TPoA?=#NO93?]_TPoA?=#NO93?]_TPoA?=#NO93?]_TPoA?=#NO93?]_TPoA?=#NO93?]_TPoA?=#NO93?]_TPoA?=#NO93?]_TPoA?=#NO93?]_TPoA?=#NO93?]_TP3s u_x◎,ld~#,a6Tv#"O> 1:|=GF~P ,NI$(((((((((((((((((((( endstream endobj 114 0 obj 9510 endobj 111 0 obj << /Length 112 0 R /Type /XObject /Subtype /Image /Width 225 /Height 225 /Interpolate true /ColorSpace 123 0 R /BitsPerComponent 8 /Filter /FlateDecode >> stream x] {:e{նV[]]y ZA~nETș=IpG? v x _s#*Op= oFA{mO7ixF.k'=#5t: FXtu6:Cu ~Ể&Bf^p\nPKN'%l qA͘AŰot TB6J>^> / P:'9?@ |9\7/$2qO2 Oѓ9n|*$`Kw 8}cEI)+F _~BVs ?Ei9Zه~y7? <8_4k,)xP`Z!Rou}z)2Dڃ&5Tb '"`B GV2MqDzxNe"p>gv*Bu5`snKzΝES?,\8'|C&ϱ\eCDzDm5Fg#S«J*I=# OT 6r)K8^+ս#A)qY52**+@p5eXvg޿5M} 1ns^J*. Uvq z%Y301Y]w )~b_+zZffvES+ wemW=D;Wbźf3!PCkGa%4j*Pُb:k`T9oM#OebvD͎͜6D %AdcPRnsLŸkPh{E֛BcI>y[j8eʥ^`!ݭ|W2,ii"@SvD}r^J#OsW䭂4h{΢L.د0/t02,e^O{aiP1=l()EPL_iASБNYB W(\}M} fJo#K >siM FC3M0pTVhlUUr:Ƚ/"468t ըfj!8y|@zSnL?13o+ݣAIJ̅]&Le Ľ32X&f-6V#= |/j*%_{Ŏ#|=a;Ds`h~HbKYJ*,BQ0ˋ*ghn$=V`L\=2P,j>JzA$6'q <ܳz{PNc{'Zь/ãC\񄾟 [Kbk?EjQRJU gT_rZEή43o$>nU5M~yo"fm0B{Cnq`2> VU (,T:mĝWgh@:\_$SPQ\Pu rt[CU1(bJ|e;gjXtPo~ bkM5&&/:dqhoY q*[p9<3; d*Z"Kdm5^<~`Nnv[>$%j6fŸcwRY&|zzrK{P\)p08`Is\3hz'3{SeFB4t8۫pCA#P .MXGX\Jl<>f6Yf%3u;4m2.6&%;aԙ6oϷvOcxiIw ,}13io}`*Q!Mz굺͞OsEmƬd 刺7]jW X$G֣WDl@S?jɠ0=,8i!И2Ie&ЬԬCvD``jX&"iE/cphZ3 ˎo1'pd @Z^/'"NL5^ $l6AM8{^Pٸ~s1:\,ULLeTs[CX7լL]79I p 8O9Ćj u\rz͞pP?yYTe|vj`ˍ)܊0mT"Hb";IT3 ?58zHwws'ߊ97c6 v0XR9Tp憄wkh7$q7x2@cޕtNVA0pw-tn5{Rf3<@#)Yq\Qᷜ&UI~B8UFZ70UہoƯOKmp$@s4cnZF}S9aу]EP 'q̧Iނwf.! y .Naϒ§T4 MƹÝMP~zϒب]cV.X|<㻻&3T=26-wpV+">r H>Dʦҽg(Ƚ^C OY"AAKi7F]J"?d9+@z9L|r`%J2#r =/h[ B""EX'lI[@˅? 3;2.6/i _f.{Fx86>H"& ( Mvo0ju:LbīNEּajq5[N݇ѠG~]!7)?MqQ%!D3Rĉ}!$aآK&_rq8 `lZ q^^dd aB<,OXɜǤFç%uų?tpt ?69[XcqsM3Sel`\-f݁hيzœ 8!c=;$ng|RF vgo3"_}ד$>>(yByD}a\RҘ`@7!Ym*[_BB*m:{U,݁z㫌i/DZa5inkq pb[L2O sHcyhg{'ܣFAY,6i\廗f$3&)4li$9wu{JݠR ?]4h?eL1Cu)qʮ' _xZ*`BET(5(P/ Hc myd& oId\A{f!Q8=!g129ǽĨ^b݈ saf!V2$XD=cJg8Po[};Ԟ]`[8qjw@w@( endstream endobj 112 0 obj 3849 endobj 119 0 obj << /Length 120 0 R /Type /XObject /Subtype /Image /Width 120 /Height 120 /Interpolate true /ColorSpace 8 0 R /Intent /Perceptual /BitsPerComponent 8 /Filter /DCTDecode >> stream JFIFC     C  xx" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?((((xkc-櫪WIH^IXDRBIP+?'5h_MͩY':¼m+Rx " ( ( ( ($eal(((?(|It؆zQr#1`yv ebcuW8W?3(+?do~^#嗉$<-7A̼yqc-91\7Ǐjo/EִBA7RIcwՕ +ۯ~߱7:e6XCrGZR$oa4 +ޟ'i <ꐟEjv{]4ktrQ#2\"qӧx?__?<=mmJd6VpFC k(v آ((rh]k5,~~1cúŗtImhid(@ˁJq$~վ 񶇦˩)`C{ĉ yf2kk hxG~~y~o|+Re-6@-!kY.Q7-Ϙe[wA#Ɉ\ zO_g㕭صZM%a"[YE[wHn+Dހ2 QFC{b_Z7Ux_"S4[KV>MӴv{4{(gvbTI M:UO:|]Oثź+;I4Koꋺ6YnoáD$| sngxIп/MϤKO\jUZV[CʸI׿~ɺ v_5]ŧCy'6- NeYY7*Ѵi_c+ ?/_jڶxVdy4EfgbTHl~|EkY>յm;"OcsOVr$[lmg ,PJ`Gq=Զ8?f] |IKɾ1jV~jd%0&8򈑟ֿ,DŽ~xf?G^;xN5xch조q$|h˄+)H<7 o총#IKT$ Q hP  ?0ĺ%Cmtо'Յg-u[4b+v5@E~8ڴn {/[_>;iٵomgc,`)ilEÉnL2 cQ9~vfXWfQeuԓ?~`?|4^ZXmKt-$fKxe%Wo> x.þثyv egbrYݙ?η%avOs O8>,xPաݿkK*QGK LSO/zN~Go;ƞ mWJ4ۥTH2A ( ( (P˵A'>|[~+W_>r>}X335n! q ?R?`_ه "{.kb𢬗s72G@#ETEQEW~C.n%uC?2/_՝6F ̙cyHk7 4kEլtZ.-omRC,RFJ0!?_?>2~Կ?C>0=&2O!$Ei$FXIQ$| a>Rk w,alwc''R e}mYc]Vo6JkЅ MHd ]8qסPEPEPEPEPEPEPEPEPEPEP endstream endobj 120 0 obj 4157 endobj 115 0 obj << /Length 116 0 R /Type /XObject /Subtype /Image /Width 226 /Height 226 /Interpolate true /ColorSpace 7 0 R /SMask 124 0 R /BitsPerComponent 8 /Filter /FlateDecode >> stream xzێ%9Oj! e;2r(qU{ x/^{ x/^y%oWfLjL;L'D3 X?ѡ\V}۾da>jRnՇea:?0|էʙtj_KW}Ҝ]Azܭ1߷J&4{rD|_)M>ФnȃCM;+KoݐV;{玙nKqh\޺sM'.5rl' g59tgee=.D4g_$uc'>z?!!h*0J!Qb*n"J.FڲQ$@bde o86mْ dc1rc-Hbdee@R|s|i?8d.(3g k4ˮ!!ߚXp##[JgpC0ȑ}WncXdˣ+Yb _W&bh11dX1NhWo9(dd r$'{lٸ51KQGy\ϱ1bΘL@^Q#x9'n) >n+-7[9'?O^fL^16m0 8N1{ME㼑C*28vn_/QF'[&s U$~+JH3rx\bJWL2,b #kbdD@Y[p xD5Ӣ fT"i(F 8TARҸ\JY0(|y`T&eL-Lr~2hz$ϽDB+2 $Fy{e[Α 0c̖0oXNT2' { 1At ӏnx%5BM8Nerq,8rTܦYR>荌'IapFc [X *X2 ֧. s 'ۺH[^avGoe{EIRhq%dKd&q:w XbKۊbc93ض !dC˶\|C&ޭd\b{|DW\LȌ99@8JRQ̮>-OH:K]VT2)5?Gnuϵrzw?V+NLӟh嬆lٸuL|VL\fS='/5guBrx:+>n{ ^TJӻ%aSٗwխKIoSg='uݗңdAI&$=z@6'>\cˇM(>zg2 G2s(iY>IAIOhvDe᭴/{o%/nxyҟ{^{ x/^{ x/^{ x/^{ x/oXgѿ[b+=__?˅D=\u^LSNS~\<8&*.W__Ca=DV_j~IWWzZ*Z=@fP/h%=9qTO+*c\el8Vis~xh(la sf4_1bÁp*SdñJ|%o媿"^J؜F\IT-IjAc-Wãc$U*d5ro^ocދY&#V+Y18"-/Fl-sLs i\ͪ {Yf *2̭/_A<"IYiDF8̙$60e#㸊J銯 ! JtL"a9*=jDVC& M l`u &x,d䐸WUdc_UD'8&Lٻʩ2fg^~UJ)'d@F`;Pehx]1pii1bYY3 ( =j12X3̴LUizKPG>FE.3+fvG[[; 3"T|I]) 5 U dGc+fFc%Bt`+ax& i0J1KӕKV>ǩh1?enlJőaȊ _A %V={mn As- tc#JEHKH6| 04-GL 3̄>IVxř{z7!+D跬L5iLe=9z++ dc]`W}:+LX&,K ~lrxe!+ dc]`1+pNcAf obcȌ*>!Lz+0<2`&XƺV0dʚ+>%c@xFƫ!|q9FRB&ZLK`M?bQ]|3QƇx;ǜ`،q d1WCu8?}尠Yy7V.!0F%4x;1L 0?ǜxueL|Xvˆ%8 b1g: w[,[V.1\Qro,10}lKVF,qۘf [XPr#*&W +U2$3:zg.i"?'יe^P_+E&ۃH0Q$xhX-|xV7ds7 M^b0!`;[YuS#MUu'e7DCϔCnbGU'`CՁXL8+XL8n㕯Jin^Ooml5Y}I^ӄ; ieYѯ>o 4e򷂦I2/o?!+' 3L33HtJf,- wNĪ!`='bՃgy/^{ x/^{ x/^{ x/^{ x/@0¼/ bg -[o; &=9LVWJ5WyTUeNz}N.+Uʯ49RjL=#+ZE'ex]Reʞ޺!CM{_)&x蒹T%\%]2}e17ʽu3V'mM7"3"c 2/H1 Hx+Aud!9_VÑqs3]_,zA8 '1F33{fYcWM2`bf 7MUuT`ۊwcuɻ lUc2a~gz+=pzyT_V}j+Ul4UE%Rd[ ! F0Y$yL1X X4IhJ*՜]LǞ4n+]PIC4cU*HɘӷۘRUT,3ی1/W1g"4c$8GcQd k#q۔ɴ6M@&e[ɌdX$]-]4}7(jĒ(&meMgJWH-04$%ٕꄋ=S8$|\kyeiBVc@:2$ $JHyW܈r+< MWLV% fڱm@4ʊެ8M<%0=4+h*F؂ 1Lv8L&nʊI Yy|#[1Ss 3cXzCLdjgAĕEݘ#L4F&5N2(z6x.jR&SƼʞIE2Hhq&J/99e RR1$["[1Q8#D#3wk˱!liirpD p+0I0 )(]F9Odre^xqUl4wKN5.sP **Ņ uE> l$FleC߃degbEd2S&=JefR5.a pW#@*8LcDDod*8a$QndY59;Ĝ1;oy v+F㡘]ˆŷ R('ұ z{Rqò&_qpo-,[ 2Gec,`ɉȸK~:Ҁ(dcoVҏQszFyw&nYW.H>5=z} q&9QUK=Ąsl[S^j GB YőK\# JVO]n,Hcd}22],4!%aLs|C`QgA*`d2f62W_ITjIhb  ׷79ȏ!=cFȫ@Fޙ[H2V}O Ihb "ox'W9v+Fڕ<[vԸ4I(S!Ns&$绞Ɠ4Ѱݱc2v>e .`V<NQ.|h̨_2}`d1x"fkDH,Vm4[D{Z9HC8'>0{O[nnJTQCǀӀc#c P1)be}AH.QC0b%K:t_JiB!/OqHz|?iC>!' R, _URU+i?:J=1)ʕՓ39+Ur^ x/^{ x/^{ x/^{ x/^{?7NoV 濭_iJ/<ʿ:؟`b&݀MCD+ɼ/IvĕO$퓆"ߎo!E%vcׇb>y$۶>@g=nݯq0y,$uIȁf1& #(x¢"yw#:<"q%v>Ju2D.3iQ&dBܵ^]yJ\qOAxu}#jT'J?X"#xBs$9`2" GFc 1DVӻmi|o{]*s$3Uf9Je5raxUn%j8!g1C[1} [D+}`ǩ2z&>n' '8FcoeƜ '؇}L!kD33ӨhLeư8,INp Ŧ9=ɝӣ=pfL*u6&%nX2rʪ2,ǘ%/*Ar $'al>DĜY>r# IqNHht+jL).9+Fqr^'ӜT܄/ mv6[EbDr2GP:`DYO(BDYL,V`hz.W: J `ŕ<[H@@ye5[d5IY3&M45bR[iNŔ `d˲^mXU 4ƳM@0qw@B}&oG1VX (h `c4: %4bqeי"4aERGkoaO'8y]Mo{bc4: %4bqe:L43%DH>J| |14 a1̂ #8b#@˚%va((#~}o=L)JXAρ T^]u =W./'@8ɩ4i([k+>֓J)Bס܂!F8z#@e'QQS9=3LLRd$g9QpǨ,/Gs7A{k*{=sdaL+I ++&Q[1Tߜ!=Sx TbyTy&+_o~\`+skOr"j4cyՇ[ΩpPYRY$z} [+>` 8 ؕ?2v  &-7q1#_ XxY 6*,P0[Qm{^~[6 RX8+#A|fF ۴*xs`~Xyv.1'D#2ccA*=yЧVxBDA-o%jusՃ,-,mi5//A܂+`~@y_ lY1޺x,>-#݀⛆=>}`> stream JFIF``ExifMM*;Ji\" >Laetitia Zukgraf4646 2021:10:25 12:13:452021:10:25 12:13:45Laetitia Zukgraf #http://ns.adobe.com/xap/1.0/ 2021-10-25T12:13:45.459Laetitia Zukgraf C   '!%"."%()+,+ /3/*2'*+*C  ***************************************************" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?.ý_˰+oV v?o~W(˰+V vm~W(˰+oV v?o~W(˰+V vm~W(˰+oV v?o~W(˰+V vm~W(˰+oV v?o~W(˰+V vm~W(˰+oV v?o~W(˰+V vm~W(˰+oV v?o~W(˰+V vm~W(˰+oV v?o~W(˰+V vm~W(˰+oV v?o~W(˰+V vm~W(˰+oV v?o~W(˰+V vm~W(˰+oV v?o~W(˰+V vm~W(˰+oV v?o~W(˰+V vm~W(˰+oV v?o~W(˰+V vm~W(˰+oV v?o~W(˰+V vm~W(˰+oV v?o~W(˰+V vm~W(˰+oV v?o~W(˰+V vm~W(˰oV vm~W(TP(Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@k} w"gɹ9 y+{? j,1FV3#HVlrBhר%׾)v,!Q0YB ݣ; |;$n|dqeyv7y6n8@EpZŝNL1\7'\NPK"ڔ>}LdSF};Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@ EP(PU-Ifm> fS Hy:0(EiwB?h0~ӏFD.n|i;嵹Sc A(.,,?Q}cWf3[(|X`W#5ECtROӖvF ,)<2((#7[~k~-M;m]9{'zӾ2|b#-#KXROvf 9?/Jz'I$9"W7{?[?4<<;Dr`I,6Bǭx욗.C摵|'"h`X +\:C**py:x 9=>E޻ݝۑ4Oܳ6';pTQEQEy7>s*R^دH&獧|z+5mJ5Dž|>jn,^]`9s2Aƾ,巳@̀dI>a?:x{@2]_Z|r4Ipyhg#V-#C6Iv1->$u*[+iᙷ#A,h@H9 1X&Dv,-V:jʁnvg@Ax= xòKw#c'v|9[ !A>p1hj[|?[K:l*$${W$~os@A-q_h^LXRig%3YZB  ]BnG>}鑔;`p_'$MK-(~0׵}A ̖4X'9[/Pj -".T aj\EHTG̷ )'K*+֚^&/.i,mG—6`;pю:4nokV͎^hpG$VJ;X`b,=Y|aј[ %Q4ڒ.HLAnʨ+X=>:&at&{]<YS":֧o jS0*hAJC]k7힕Z$Ҽo[1$v-t<>1b 391@?5xςnW.G5G{xV"J΍@-s2k~|8Yqswxd>OA$ps -<;Xk7Z1_݌Op2 ^;b^,Ҵm?Sִٴ6P+%`#q8#oJZ+/SS>˳2A$_ gvfuB=}kɦXj$dfݶ0Hix8=~j֍kCsost܍({CEtEF,̀y?yfsuz.4R;a~/E"wZz>`S5?߈QXWѢS-\"^1HU\AQ+x-Ao:B7 |hcNJ5kZ4\> E,qsm. s57oSAHKXźE(r3+|}cAmkS, %kfY1s,uo5e$n?hpAwq5PEPY l3^kZYdƅ8X%VŢ_Ebv9~=pHJiMfNM6q Yv@X ]űe3?FeAhd@ȭ,Uw g?~$jV{wW׶!6fy]p|MOi8Zi451;D̯DSV.3_]Ī=ŢhIggE* <@|K,->my#Mlq):8<5|esOk[HmR!U@;j%H"w=Ⱦ[NF>l`OL_P5 t}2hOKv|Xvع8~oq3̑Eo=?1 ދfN=emlO`#š|Y5-f,Hp\.vM Cݍ63ni*ov0;񑴁Vկu3OQf7X 2.qCr>lMKY4خ-%\Y4r$fc9 u=^m\D @@ 1''ߊu`&n-ŤOcPec*Ս/ƫsAM"KF)g(JU;ۓR7Wn-+VQYc a60@ mwG9 fIKco,#p@ǮjEBac+!e"<|A9uSlgRK Ė,fedU#=+ѴC-em.8PM\`mb##(g!H cjkcx^,gm/ jIsq9˱@l zoq@zlO[heەh\ y_\^'tVMiɑ!hmB<O jilbӵ+J|Bh_/$}T4:k!(^3qt썃%v@_=i&mW+=ɹNvs@{U]Og+[`A?|/C'Aq$F1Ydi7* A;Y׼C?&&Mu1Eku<sĐ$(I}/ my ̑Λ]Aƥ]NŵF|H<Ō+|x^[qv$VC.l07WaC\?h$m.ү4dt%#e m܊9m{bM|qk4~rܼ1 y˜dn:k7ړ q+ʮЙ%B pHlv^AwxfXdJ47mv[in㎵QEQE(EQEQEp|%Рך{ȥP/ocGҼ6vB[S6?zGy#1%FT _ھ<޾Kc@KJԊ)W̘q>ؠ em2u 4+,:J*i<^(w|Ik GKq3hI]:xGRЮG~0ESQ4}xι<2Ix " !m*ߎ f CKuqy6?iYfYF9 _w?-,~$n%b{WB?\V nO> G7zI4VbdGR`c|r=k,x_N?Í Y} Eđ$jͼpv$Iǭy߆!gcmOu-wkin\*X? <7W=݇# HB!n87c#:X^xFX6XaP}rz<8@MO{i\D&e-q1"[LXPH~S62H7eޟuP7T>ޛ/ڮqugikvT pN_a#}o;z W}u[m-0d3]%s?36ooֆ $q|,v3'hw~.74xzk1!H&(f3!ʸ]j.lo,5G~%oqʐWSW^>oZKеkHhrU;F>zqZ~e j?Q[Ago Vo,8AdYy4i6?.muPmfm#H[hwd V*x|;GWծӞ{E^K}F6N1?%͏{| ur&h<,TlAUGz7/B\_M GG1O$O+w\Wz_{XRO1).`/˹A'ր:OGl,^03|, 1碂0r~~W|!>/}g}>HwE| ?A]y44HtW  r>SyC DQ a4ڧ̖ U8V<׵ +喃hu`勒,)F%RxZ^kΗW-\E焟wʻ@2CW־j6S\:zþ):Yk>vy'$"$JTmݗ=MiG_hû exvHffᡝ&@It %jnS }8(|Y&!{f"'yD)m';O˨:X#K/d*-Q ;1^χJ-til^BJ_u|9{߇:噛jh?Wi!E`_|9#>ESXm{xUCtx_ <+ BI\ ^ÜWE:NZAoRʒ s? +eះgI{Hgvi2=Pv`3]2" x(P0@vEPEP^#ŋ 5]&b!% m}c{׳WAޥ\#jҾ%P#>gy!>#(|aui]xgBO^:uQ(WwC$}0qZ=񎍩_muKr\tr3D`;/=H9/4j{(]B#}ՆxEKۦ hbMý=Рm4uCODΧզ'GKʥCc ];PWzkkAۢ=|>Fek+\VĿ;heԮKGY"vBrN?.z힧h"l"4]兠8dvͼeS5unVΑ]-!yBoo4T_iZ-B;˃h$h jBI<GJ|I-#U񼺁ǧͼ~ӿ|R*PyE h-,:Ψ-Ւ|HMpۃ Cmhumczj:WH6swmf"w5>QEVѼ:>eoys` n&=XolX9A,I(Rxg|W_LYe @,'4x[CᮟG]N;!RyNqzג|@]/6rx&MErMcFFI'#>SŞ=u_|!m.}s]Mޓ?:[O̶2 U j;.#b@'(KxW`ol/RJ:8mWTeQ-AJE@qSjf/xY~Ksb llmA"2 ]Eaosohad\'ԃkVe ѯZ6=I*֓n1 $YTXWChzfW4=Q5d=H kC^? u]XoR<0:Ax02vȬ25ҼIy jڗUPމCe+/yޥiDvNE1T%LjK⻛ kn PpF0Rr95mF MuwX$.¨26 1ϷzkgB񿉮euspq@Pݲǎ|@v Oӯ/n4#48TBH)ӌWQT<%1;;ig6J.%XƟP%֤OBTH3+B6;K:4-֫5 u7ouT *shf/nuvum8YE,l[(͒{WxTmCĺe-쐭Vahȥ ĂTq]K[6߉t{K􄷸eA/1o> %Ɯ&hc?)#n;Wׅ~mu˶1Zh`#<`;]&KZg|5$|5kϛq 2.݋#k|dƭRl>{F 1\ssvW)'msW>wEě3x5tPEPEPEPQEQEQEW!a, ,[b˜&qd( ( ( ( (+j}csk:Wr_i86U'3p8s+zI#ƾ4""^Cmz ~Qv?|mb5DedӴD#]<Qs]γķwztO iMki'r-k " ;{kwzs !}}+ohֿ}ӽ։t7G`6$ zoeicyj[?{ dHVA+l~۟S!umUv'I⾞M .q{}AFD$d#AjxQi@5/2ۼM@=ti/uTt*G@200zT?`~iHWe<%P:W|St>lKOM3q~,S~:jY"8 O[gie Td8Ƞ>"}JRivh^{d_]>$P}y.& Z]2"CPJsեCÖ:-ʇm2XddV૝Eum PYd/qz ߳ w6Uj0[0XK͋x7\jX|ZNahv%ŜZ\# \%o 5 &-maX!vȪܳA,[ˣeZɢR UBOݼ@xKҾ%ӖRZ Xcf PA57VFAر!` H$WwJ`):eχb 5';J=1^kkY!&TXtEtU٦i.r 5 r*FzNvqIs|7MX49X Xqrk:ڐ2yR&f3sw1xצy^yG㴚;L&UfLZn<9 yDŽVľ)Դoa\=0xxr kuOIxMfl4LU y/d, zwx^:3U4HG[F1,-dውg69TnQ.E1K;! 9VG$`0zi)ǏkR[PM ɵ$#wܹ=eksf=A&Ί&`sȌd.c`8k|χtrhT䴖+{Q#5`O^/Ե6P(;ɌqGI pH'ր;/.]FPd7Q$2x :c5>Pc $tJ=Yά07(}kմ_Z ծ=W22y̐`68~)TmM6Ys3àG@9L8"nശdFVZ[3 #K!=STH4,(IܕשMo~uk[IK=Rd4Bg0u6 Xjh2Zl*1Zw[ZVo/ԃڙs)ߞ1^/?ok*Smlm*BF9^;voi/43U24 @H ~fm^+o#Vt?$`%Ey(^l}]w;0:JJFONZHQEQEQEQEW|v~!!< sv!1'{q@9ۍֽ],."ZpT$_vQǧL%Jdl">]3 /g3i`B`ɷJ᷉/\kw;hEU~CzO> xoKaj3ȟߕ;$^N{xj/]t>'[x]rUf`?&V'4k+-c"_%61܀5lCNVMQ^hz By$l*ʎF2 GǞuO[ aZ<NNaAPOEZ+-YtOmy.ϩ Wfpc<_H\xIx˥Cn+"Iu۽|xt^Fz??~&MNN>;qdfvL8;$jc%>ullt"uv26B}"\jgCm 坈w1ե&H%<7'E=\]0&EsXB2xf όlu; :ȷqu b?*Z|O/n|Ug2ZͥڠiBZ(a,:+xi6(>[]``;֮_-_i-fM*)P9l|EnWڿ}"=:ŝ򤈐GH%I|GioU4ٿ4O=JVI<̀QqN3\'̷Zkcoj|cJn퓁FzW|[MhW1 7' n[ .k𥞙{-OĚƣfuX{Tê_v8UDf5)[dأn3 *QdӚ +&^}e we=W9%99hx:6AYkt2C*X< |s,H5jzRk8qoU\!W=;_km]izsm ʼ{g/1@$<ƺ$tآK.fxAz'usO~,7L6m~tJpWf-j"ћKukJY`X.KnɸIx h"E@V͵q__ tZM'[.}w"G_  #m'Po iZBX.$KM*UITO+  'Qbƚ}F+K7"QEq0 ,dp̙y3K|a:g$jz&o%^7bqb2:2r tk/ |@Ɠ,sVKbmTd\`cK41KjYY%!eurθ\e5\k֕16ki+N229~`sh+hj6Iei sE6BxNA##QcN ءG,߼Tbe>/I~;-t2hq?xv*&n弛s,,yUz?4OĖW^"BTms'<}o:\<'1ȡdPϟkaMq$\l%Ћ8ao™sx厰@"|:ѵB|u096𧃵=RPdچ0L,NW,q~1 7x"Ҽu Y_&m, {xV',clw@b9^Q}RpĪPxh :RAu| 09QOQ~2+]nu@J1DY_46Mg}bzΞ.&[@~\aPKГJΛosegm{['t. (Rx4-!&ir)eY#?C]X1.vêjQNvxĚECUֱm-j0 Z5[r31rI$ T+uxz^__E&w"0 皣+M#{MV 3ief(#s5|8sCOo|C>}:P/ FPYA*3$hoi]dԴryHb{RwR {U{ɼJ qPSc@~#Ćd2lb'wM,ŷzP O*xΔ-"#j~*7Q[;ia;kp 1 ˻=Z^*xgM_ x&M.!- p79 6f ΑzflTHP2zW|펳mZ[/,3#Z P2[@+xZ q+(S tPO1ֽSi,@[ZENF@P7O.qK<˳_(jvv%i!2.ǟ.8<+?hN?2 ;ov+`hͼsxl[i:r;yR8{#geYV9T23W /Ki4Z:r2&ۏ9T`1#8cxS¾U[x_&.g۹Kc?$!<9v%Tn&/Yf豯[ nGZyH]f54jR-4UHDđ36UU_vsh-0Y\@9 zCL׋/Gbl|;f+ſF5 9,vМ|u&}R9 Hfib26$˴Co>)Yyax?tu!Ӭ$r@ WpP̸@_|mq {_Imi0yg$kW9tI#Hd 6Ӗ߃^=׼eo+5*J?WwpjWQKqw>HXlN$,s͂xs,e6յj:wс]Xop݁1_qWľ655k+9meM bG+9/ËJ^o5[˫mCWeݜ ެ d1#ǧkpGC_/־ҚXݻǐo 8]ghZlT[nb?+n9#"cQxF Ήqh"cfB0# YP݋E%}6}3Z٭+ =,f H,X WxC75񶝦Xr[AgMF>]zT;UiQМV/,QkܮP³xk[-J<".c8ňp=uz<%{,0ÜGb +?<+R.l5><6%ıKpA'=ש|ΗMR %amO ~c=(]̗֗V&rGcn Y>$+ƾ; }5!6$CaSFnܓ|;w{m24)RJ <`{q]>~!|GOE6jH#dds<fX6劬x@cLjn~Ѭhv}ҽ1yi#Q+bWY PK$dX#p^9|%c+j ׾#dȲi5s:8{P7aԭDIk:O-JK`a-ɻ* ÷~OJ}GB񅶃[BVCytHxQV1\| kvN]Au1 CH'KRoKn!]cP&XʼR$+)c0q[~3|[SHBMBf3\cnYh}Sm|=;FSdԡ!2sI^[I!A_嬟1]MX|CcrK+xJ=,)U9 >uh< &麄$(Uj\muFm\*|ox]M`Z w& s >nx>f5ښbiGS^WAj/-Ws Bۘ8T7?ZJ]ZAZls3tevn(wY3xSՆ}HXZ_[G|!{jZQkuAhlmwc%IbxJcՏUMPQ;bHz@>֫Q ZMtA/5kƟ<3Zx;Mo4Hcq0^CaT=s^Qb)<⩐InDU|+[PxoX9&Au<-xC5'爤h6Z6`Ӈ{X"^'H젔&}Q86g <3+kS񿄼8V&3W]i60$lW!@?ʀ-W9?xz|7^%6r8U#gw dw?Jþ>[Cw_u Mv9rȝA#>>%xyt;[ºtf U1qkk 67V%ռrxc f (zc5&۪}M :ix]{k~0񮍫5WƑ^Hފs7c4In XѽC$* /sW矀"44I5ZFQAs#Hbbˀ z1(((QE(((((+?h|>#p׽#:W T'|Iʒ(zkWMjo=ed-m#b U t<ORMs7mַ nJ` lL3V8԰,XREv-'ʆ9q?oSx_SW& Ge11).(p@5޷g [&Dwk.IT<漯e)}-8%B/ApJ VKΙ& j#Rćlke8 K.VCrS@KfT-sf((G"GYOBjuZ56A0[ }grDoSW^=(9A`$J*,uRkY[XQRYy 2M}w;K9Ke[J leIoCK#PwElNeeHN@,_x=*NKVM7Vż]c9 *>\ҳ~'x >]U{gٓI6mx1Z/F𪟰Ɛiʗ:ʶ0)vI `v+>O(^As/Wb 6Y@m7 fm#Uծ !g= ޾x|uV-VL.[Fy$[젲g;N9%x?Z״OiRK2Sq8z:׷EPEPEPʖִOuw56ZVqʃ~aZF{MSrnrǏWU? y¿SZ]P/n!-FbH׮:o7H]'2]}Oi6ÌUٌ_5z׎h4[-;Yѵ8Rpx"%*m@&7 oВ ͕).OXqRH]QEQE%Q@ (Q@Q@Q@Q@Q@Q@Q@qֺDž+?f_#_쵿}n.{8&,d']'%'/n.rI'@tQEQEQEQEfE][ |7qzO*o.mHN~'w$5մws[N7E4mq#͞1A~p~$m+}̳s(sGմ8rG(R\VNsx2# |Ii2IGw{"ADC7\ gx泦h>0Ig,ycQNk k3؋$ ^<~ #hY8 Gz~:5R]2+NwCP"7%V6v>>滏 =Ljl÷,H;].an88*=_+ſߎl#&hmϚp?S_y[[4pG<-+cA|_Q{pJ=g/o3M ^\Kx|O1ivl4@]-QEQEQE?@_zd7wZdmdmQ@zt >>boI۞y<dսN9}uywWkm#Z`;FGX|tӵMw֙[,o-Q"܃$gw+<+ 5{)닉r%9sFDt+xTY_WZM2.m’xFY g1\7m&Vծr4]*x M2y-N;U~6Ao'5xfDZK~V#9⺳t=+R4U2JȒY #ʨi0HT<@[ߊ~{:u:k %UH1>j| i}S^Ѯ9s -SӛǨHWk0*`>l`)toqhXħB2yr- vqH>мIФ4Fd:3f|Y0\7\uK;n^F D[Yǜx%>,B"9o -cTCv+;iXfIud=APm{+eVs]PEPEPQEQEQEQEQEQEQEWvmoCᛝEk]*QH&G@[=k+o?m߈amu9=i'J ݐIG{Q}΍E?)X`wXn$ĞI2o` xgv S\[F 8 14z [^#H9J;TFzX/-FkiȤyQsrIc՟~WXkyo #3.$I#Ԍw԰br9( ( ( ( ( Oq:VJ68$$G++X.xah$PAG> --4R/Vcw(~47.U)"Ee=AEzƝ.G*;HcTjcto>28/%LEs~'FqR0:{WҤ|ogǿ"HiBQ(Hy!K3Ҥ-!Pa#`8-|?ZxRn.-BH]gϵ}EfsL}^,+ZEnΣ RGZTQ@Q@Q@Q@ |1 կw2t&ތVkNt?G q@Fk;["+%峣G77\]Znنm|9fЬ@?x# m(ڲ1x Q`U:ZI%̷+2w>^4|1])f2B>f Ƿ'e$ڤz?u(B[9 :sX:&}a f ia*&c;I4ku2ovҀ4yh;oOk}g6C!Hdck#7䙥]"k`8#50p5OOS ?rMzw&Y5))(*z+^-|%o#-m|J_2ˠxĶoKMnl$pC*c w6Ӡx+Ajz?z_#o,=ϐX.尡;A8?,צPEPQEQEQEQEQEQEQE)k/ont+h.k~69mbעheCYw"e2F98=hTZ~啘)3&۳_|?ev_|c?7ڀ9>}SN[Hx Rv G:(((((((~;7ǿPnIE$Rh$ŤF lJkCȎʱ\zPG;F*}O>(((((((jU𮅱B d}kZ''T:tE=5>? .@kq5yleH8==*ï:ׄ-x:aFlcr]:#c0<gGThkRZ/Iy9M~:kqT]'O4,5(/m%g:Gހ>Y!|/%z/]o{,b4+L_{x|E騑q10+_fCp۸>wMgw_\'Eҵ +6n齙\c+鏅Ҽ'{%c4+IK1]g}+5= (㼱\#ȬH py潷Fm/Bw5p\_~𮩫@[+Y'U$W~"+m+Fi:2_]JIySwɡk'mwx^hEi1X~iu׋ٖ.%BgG3Z>=~nQji7IL*O k_ ;5_hEWU d-F 2%2X :((E (((((((6GzMr'sZa%q߽}+Xg}? ݪXgH$~9QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQESͅ7)\fh?g }(jg[V}N›;~5?gS>h2y`_3a؝-6 zW*9m⏉QxmZXXڬ@7@yC]д<q ,)vSϧ'=_}jPy.^򼱒=wҀ ((P(((((((((((((((((((((((((((((((( endstream endobj 118 0 obj 36957 endobj 109 0 obj << /Length 110 0 R /Type /XObject /Subtype /Image /Width 253 /Height 253 /Interpolate true /ColorSpace 8 0 R /Intent /Perceptual /BitsPerComponent 8 /Filter /DCTDecode >> stream JFIFC     C  " }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?((((((('Mԡ4Rn_ZA*( ( ( ( ( ( ( ( ( ( ( ( ('5S9E|r%֗鯵) K+$@  Q=_uMے_&X%.BN"9(KJϖE~4]_Wź ~3 ~Ʊ Ǖkqc|q7󉋑)_73LW3ŤF$r|A!?lƥoڧ-JyabPg W@S|Zj2j~|ODF%[*j>z'#~_yG 7?Dx__oyZY?n~U_أ Yos[۬ׄ}_J'nr<-#5 ~/P Kgǚ|Kܬ^4zr _Wlg6%W6-OF-;ʌ3{+Cʕ'`+@Q@Q@Q@Q@Q@Q@Q@Q@Q@ @PI6<#Rxg{ 3'~/k)s#ߺ7 O(|i w:طD61G˹@XڏŝrQo.tѵ5F1@[SQEQEQE%݅W2C<2, hr<:TtP-j~/Bx]8}Pr_ZaV8'+0=  ?M/د?9YxG]KuEv$ L9{W|?0P[iB.Z G4`&|Jn7?e{suh:=HÞJqt_Ng|.6WW΋åDRǜJP6AbXuoZ-4~6-x\]|8=΋`-BЩ Q$ +R߯2'NJ.g.Y#óa_,oTm6@EPEPEPEPEPEPEPEPEPk/lj?_#ǙChi[eģdq_cBs|ԿgOgRx:}ê\ٳ HIm$r  c^ğ+׃uMYn?Itnd=8 _fgk4wzԏ<#TJ3UA9Ooi G Mtb| O!s3ts@n:W쇫x?MWqX2kO g_*tyn-|7<0Bcjhj^ZзJ_/kK7~i1Z){v+|@ĝ~o|F RFRֵ)n%rrY$h/MO%qdg ^8ڵ=3kgݯl; AEx/}D#,Ķ\F=Bِl`=zW_.13|@Cvu#PXCo#`&ҿพ)xX8Lvs?m?ğ+ZĖ6Q7Ea O&7P*[|>ck::A&fTV`}? ˯k?xu'KK?Gx9Y?~/w߄'G|nl!F"G`>RV4 O^+>&+Y>/_|%s-*DEoP?া*Wōsq\:IgeQeUQpk|Ihj_thv$',8ڇ._#'t'$rZu~|P1G \k#6gn~f8|8)4+o,=xaxCCcqŦGU< $U-S|m?l'mKᛅ= qQ,]: nh@?WZj*YԦg8wX@Pc>V Uп>$icKc^R{KHuT7[OBUr N>/~|tƋ =g0#txa?f?@x?7rm7^mnY +AJ$1xO~П~4Zx~_.|CuknnW nmv(p(m P?|߃xwm5t ً~.y#⿠((((((((((9Q@|+ok> մI>b0FyZhυ~-j)t'T?-aF!'v M2wU-Vi?1¿P̥`!^ #1ebQc ;K~ _⏇+N|3SNִM{Pp/@P%+(nrbP]?4 _Co54fU:-V<αI$Sڿ71-~xVd۬mPIbee?B+ټIVx-A3\4WW_6YѺ̀6E~_:?J&/Cտ|g\%ŏi׮dKH 5\NNj[vI$-$1fv'$z{!oNcO˨?Wmoc#ZIn *bo&3<lڏ񧄼}ͫC(eo8iE"$wGBJUl`k_K{V[_Oy#EI?@s pW]Yl~9 &{戇xd0\Fg?.Oƿ_)_׋>_ cѱq ZaӖi~џ?/Z7 |2¿ivZ_{ (0q]EQEQEQEQEQEQEQEQEQEQE|/>F?c~?m6լ̚&cu|\/#2:}HȠ ~'Q9|cM'eCY[TUЫIs\ ]^!W O ڿ4[bc?b* Oݓ$WA~οeO O xH晫ZlFH!uoM!b63F#s_ *1š_/I7Ơk|Vi~?>$x.6F_^1]جx?9XFpn y!U  ھ,KO/~|^75ƺu>id_@–D~)BirrI$}_<S  M5'a}e mc$S;z?7źT?eK S6X8%y? ++42VFG<[u52}6' >y&?''C_7ßڟ~/u(¡HHھۋ &>0^|EWuE)_ҭ-Br !G?>.V'妵q kk$3oY 8V89S[ߞLJ zZdbȒck0$ ~=[=uk3G$n9#bAt ?Q}nOX:{nI.e`M l\[@tW~߱Ɵ')٣㖐Z=ZKQpr2qtQE~GoВEn /_ .qR2>`cU>|)4m+? mk;]\wyvF-#^:kyOgh|=\HQ>hOʲ5EGws aK7bo4>C?)2'l%;w>U9(_K 6?cڇy4vOLN3rzcWY9iGi~xK,~_$etb= zo]|>Wohz_m7}2p?CibvƦt!YOFVWۙ'$􏃟?k*j] V&H[Uo&T9/BGXk?Oߴ*\χ]xnVFXg  dg#_7oZ0imCXǝS $\m~|l;||?&O jXj|ˆd8Ain_n4_xvn,ao@ q>/_8_?hO??g:m6幸M91˽p@?:GoT~>Oy~*H|s2%xYDduʼ= qkρ_DC'۴ ao.ݫVoٓU$Ɩ3xVOX1o _-c_qm9h 5_7mϋ? 5|#m<DE"dè2*U?5MOR5+oX&绺iXgfbY$$rkO" YU> o|.zw/DhFv\®țlr y|JptQEQEQEQEQEQEQE}9_|ח)Ze/Nѕ/S@((((9nC_=qP Lco:&nj47ԡPfxGyVˊC"_ٴϛ"jM)=ȸ::hAŮ i&kY%܎ Q@4 5GEd+A geER͞$E;⎟go \_>;n(f9h*( ӯ|Fky??y_գo x/*^d,c_/U{?_&Ŀ?tdo ΊVXU3ހ?Z+e2g )Von7ækvv8ͳLG5/1W|+[KlA-3C{d5>@WQ pa7-[߀= }5G (;|%W|eVX."\QX$hmDlVg&x kؾ] mvvf_ VK >7]aX#޾/>#x&IoxÑl}_TPn~_ŲW2gXcY yfIXvfhO*#UEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEP endstream endobj 110 0 obj 10487 endobj 121 0 obj << /Length 122 0 R /Type /XObject /Subtype /Image /Width 172 /Height 164 /Interpolate true /ColorSpace 126 0 R /Decode [ 1 0 1 0 1 0 1 0 ] /Intent /Perceptual /BitsPerComponent 8 /Filter /DCTDecode >> stream ,Photoshop 3.08BIMrhttp://ns.adobe.com/xap/1.0/ image/jpeg Impression 2014-06-03T17:36:29+02:00 2014-06-03T15:36:34Z 2014-06-03T17:36:29+02:00 Adobe Illustrator CS6 (Windows) 256 244 JPEG /9j/4AAQSkZJRgABAgEASABIAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAASAAAAAEA AQBIAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgA9AEAAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A9U4q7FXYq7FXYq7FXYq7 FXYqxnzP+ZfkLyuSuu65a2cy9bbkZZx/zxiDy/8AC4q8s1//AJy88mWhZNF0m81R1rSSUpaRN4cW PrP96DFXnusf85cfmDdBk02x0/TUJ+F+Ek8o/wBk7hP+EwKwzVPz5/NzUjWfzJcxClAtqsVrQf8A PBIz9+KsbvvO/nPUDW+17Ubo/wDF13PJ06fac+OKpRLPPNQyyNJTpzYtSvXriqzFXYqjLbWtZtW5 21/cQNUHlHK6Go6GqkYqyLTfzd/M/Tiv1XzRqNEFESa4edAAKABJjItNvDFWa6J/zlX+aNiwF+bL Vo9uX1iARP8A7E25hUH5qcVeleXP+cvvK90Vj1/RrrTXNAZrZ1uoq9ywIhdR8g2FXrnlX8xvI/mt R+gNZt72Uiptg3pzgUrUwyBJQPfjirI8VdirsVdirsVdirsVdirsVdirsVdirsVdirsVdiq2WWOK N5ZXEcUYLO7EBVUCpJJ6AYq8c8/f85P+SPLzS2ehg+YdSQlSYGCWin3uKNz/AOeYIP8AMMVfPfnL 8+/zL80l459TbTrB6j6jp1beOh6hnBMr1p0ZyPbArz5VklkCqC8jmgAqWJP68VegeV/yD/NPzEqS 2+iyWVq9KXWoEWq0bowR/wB6wpvVUOKvUNB/5w6uCFfX/MSI1figsIS4p7TSlP8Ak3irPdK/5xa/ KaxINxbXmp07Xdyyj/p3FvhVlWn/AJMflVYU9Dyvp70/5aIRc+3+7/UxVOrfyV5Ntt7fQdOhoQR6 dpAu46HZBiqOXR9IUhlsbcEbgiJKg/dirm0jSXYs1lAzMasxiQkk9STTFUsuvIPkW7FLry5pk4pT 95Z27frTFWL6r/zjz+UOpK/LQEtZWFBLaSzQFfcIr+n964qwPXv+cPvLM4LaFrl3YvQn07tI7pCe wBT6uyj/AILFXlnmf/nGX80dEDy21pFrVsm5ksJOT0/4wyCOQn2UNgV5jdWepaXetBdwTWN9A3xR Sq0MqMPFWCspxV6V5I/5yP8AzH8smOC5uv05pqHe2vyXkC/5Fx/ej25FgPDFX0Z+Xv8AzkH5C84G K0af9D6zJRRp96Qodz2hm2R6noNmP8uFXpuKuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KsK/Mr82vKn kGwEmqTevqUqlrPSoSDPL2DH/faV/bb6KnbFXyL+ZH50+dPPczxX1x9S0etYtItiVhoOhkP2pW92 2r0AwKwzS9J1TVr6Kw0u0lvb2Y0itoEaSRu5oqgnbvir3zyF/wA4lapdiK885336PgYcjplmVe4+ UkxDRp/sQ/0Yq9/8o/ln5G8oxqNB0iC2nAobxh6ly21DWaTk+/gDT2wqyfFXYq7FXYq7FXYq7FXY q7FXYq7FUn8yeT/K/ma0+qa/plvqMIBCesgLpXr6cgo6H3UjFXgvn3/nEeBhLeeSr8xvuw0q+NVP ekVwBUeADg+7Yq+efMflbzD5a1F9O12wm0+8StI5loGANOUbiquv+UpIwK9G/LH/AJyM83+UWhsN UZtb0BKL9Wmb/SIUG37iY1NAOiNVew49cVfWXkrz75X856UNS0C8W4jFBPA3wzwuR9iWM7qffoex OFWQYq7FXYq7FXYq7FXYq7FXYq7FXjn53fn7Y+S45dD0MpeeaHX4yaNDZhhs0n80ndU+ltqBlXyD q2r6nq+oz6lqlzJeX1y3Oe4lYs7H5nw6AdsCvQvym/IjzL59kW+lJ0zy4rEPqMi1aWmxW3Q05mux Y/CPcimKvrvyR+XflLyVp31LQLFYCwAuLt6PcTEd5ZSKnx4iijsBhVkmKuxV2KuxV2KuxV2KuxV2 KuxV2KuxV2KuxV2KpT5m8p+XPNGmtpuvWEV/aNuEkHxIf5o3FHRvdSDir5X/ADY/5xo1vy0s2r+V zJq+hoC81sQDd26jqSFp6qD+ZRUdxTfAryfyv5r1/wAr6vFq2hXj2d7F+2m6uvdJEPwup7gjFX2J +Tv57aH58gTT7zhp3meNKy2RP7ucKPiktyeviUPxD3ArhV6lirsVdirsVdirsVdirsVeO/n9+die S7D9B6JKr+aLxK89mFpC23qMP9+N+wp/1jtSqr45uLie5nkuLiRpriZjJLLISzu7GrMzHcknqcCv c/yK/wCcen8xrB5m81xtFoNQ9lpxqj3Y7O5BDJF4d29huVX1jb29vbQR29tEkNvCoSKGNQiIiiiq qigAA6AYVVMVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirwz86f+ccrDzIJ9f8AKccd lr5rJcWIokF23UkdBHKfH7LHrQ1bFXyiRqui6ruJtP1Swl/yopoZo2+hlZWGBX1x+RH59QecIY/L /mKRIfNES/uZqBEvVUVLKBRVlA+0o69V7gFXtOKuxV2KuxV2KuxVhv5rfmPp/kLynPq0/GW+lrDp loTvLcMNq9+Cfac+G3UjFXwhrGr6jrGqXWqalO1zf3kjS3E7mpZm/UOwHYYFer/849/k1/jPVTrm tRH/AAzp0gBjOwu51o3pf8Y12Mn/AAPc0VfZEUUcUaRRII4owFRFACqoFAAB0AwquxV2KuxV2Kux V2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KvJfzy/I2y882TatpKpbea7ZKRyGipdoo2ilPZh 0Rz06Hb7Kr44/wBymjar/u6w1TT5v8qKaGaJvoZWVhgV9m/kR+ckPnzRjYakyx+Z9OjH1xBRRcRi ii5RR70DgbBvYgYVeqYq7FXYq7FWmZUUu5CqoJZiaAAdSTir4W/PD8yZPPPnWe4gkJ0XT+VrpMdf hMan4pqeMrDl/q8R2wKx3yF5M1Lzl5qsfL9h8L3T1nnpVYYV3klb/VXp4mg74q++/Lnl/S/Luh2W iaXF6NhYRCKBOpoNyzHarMxLMe5OFUxxV2KuxVhP5nfm35Y/L7Tll1Fjc6nOpNlpUJHqy025MTX0 46/tn6ATtirxLSv+cxNZW/J1Xy9bSaex+FbWV0mQePKTmr/cuBXr/lD8/fyx8z8IoNVXTr19hZ6i BbPU9AHJMLE+CuThV6IrKyhlIKkVBG4IOKuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV4T/z kh+TC6/YS+b9BgrrtmldRt4xvdW6L9oDvLGo2/mXbqBir5d8seZdW8s69Z65pM3o31lIJI2/ZYdG RwKVV1JVh4YFfev5feedK87eVrTX9O+BZhwurYmrQXCAepEx26VqD3Ug98KsjxV2KuxV5H/zkx56 Plv8vpNNtpCmpeYGazhKmhW3ABuX/wCAYR/7PFXxfgV9ef8AOK/5fpo3lGTzTdx01LXdrcsPiSyj aiAV6eq4L+444Ve4Yq7FXYq83/On84tP/L7RhHBwufMl6p/R9kxqEXcfWJQP91qRQD9o7DoSFXxV ruu6vr2rXOravcveahdvznnk6k9AABsqgbBRsBsMCoDFXYqynyn+aHn3ymyjQ9ZuLe3X/jzcia33 6/uZQ8Y+YFcVe2eUf+cvz8EHm3RtujX2mn9dvK33kSfRhV7Z5S/NPyB5sCLoeswT3L/8eUhMNxWl SBDKEdqdyoI98VZXirsVczKqlmICgVJOwAGKsK1386vys0OYwah5jtRMPtR2/O7KmtKMLZZeJ9ji qAtP+chfycupRHF5kjVjtWWC6hXf/KliRfxxVm+k65ousW/1nSb+31C3BoZrWVJkB60LIWGKo3FX Yq7FXYq7FXYq7FXYq+N/+ckfyqHlPzINe0uHhoGtOzcVHwwXZqzxbbBX3dB/rDoMCpf/AM49/mcf JnnBLO+l46BrJW3va/ZikrSGf24seL/5JPgMVfbGFXYq7FXxL/zkh5wPmL8zb23iflY6IBp1uO3O MkztTx9YstfBRgVgvk7y5ceZfNOlaDb1Emo3McBcCvBGP7x/kiVY/LFX6G2Nla2Fjb2NpGIrW1iS C3iXoscahUUfJRTCqvirsVY5+YXnnSvJHlW71/UfjWEBLW2Bo09w9fTiU+9Kk9lBPbFXwX5o8zax 5n1671zV5jPfXj83P7KjoqIOyIuyjwwKifI/knXPOfmK30LR4+VxN8UszV9OGJSOcshANFWv0mgG 5xV9u+Vfym8k+XvKieW102C/s2o9695EkrXE1KGWQMCK/wAo/ZHTCrBvN/8Azip5A1fnNoks+gXb bhYibi2qfGKQ8x/sZAPbFXiXm7/nGr8ztA5zWtmmuWa7iXTiXkp2rAwWWv8AqBvngV5dcW1xbTPB cxPBPGaSRSKUdT4FWoRiqmCQQQaEbgjFXoXlD8+/zO8scIrfVW1CySg+pajW5j4rsFV2IlQeyOMV Z/rP/OYHma406KHSNEtbG+KUuLqaR7heXcxR0j4+PxFsVeQ+aPzF88eaXY69rNzeRseX1YvwgB/y YI+MQ+hcVY5irsVRWmatqmlXaXmmXk1jdx7pcW8jRSD5MhBxV7V5C/5yt816U8dr5qgGuWAoDdIF ivEHjUARyUHZgCf5sVfSvkr8w/KPnSwN55fv0uSgH1i1b4LiEntJE3xDw5fZPYnCrI8VdiqSeZ/O 3lLyvb+v5g1W309COSJK/wC9cD+SJeUj/wCxU4q8d1//AJy+8q2l56Oi6LdapbqaPcyyLaA79Y1K zMRT+bifbFXrP5f+fdD88+XY9c0cusRdobi3lAEkMyAFo3oSOjAgg7g4qyTFUg8+eTtO84eVL/y/ fABLuM+jNSpimXeKVfdW+8VHfFX5+6vpV9pGqXel38ZivbGZ7e4jPZ42Ktv3FR1wK+zf+cc/zCfz d5EjtbyTnq+hFLO7Y7s8XH/R5T7silT4lSe+FXqmKpL508xxeW/Kera7JQjTrWSZFbo0gX92n+ze i4q/PCeea4nknmcyTTM0kjnqzMakn5nAr3X/AJxG8ri+846l5glWsWj2wihPhPdkqCPlEkgPzxV9 aYVdirsVfGX/ADkt+YknmXzvJotrJXSPL7PbRqOkl10uJD/qsOA+Ve+BXkUcckkixxqXkchURQSS SaAADqTir7j/ACO/Ky38h+U4xcxg+YNSVZtVm2JQ0qlupH7MVd/FqnpShV6PirsVdirxj86/zH/J eySbS/MOnQeZdahBT6jCo9WFv5XuhQw+4Viw/lxV8iancWVzfzz2NoLG0diYbQSNL6a9l9R/ib5n AqFxV2KuxVkflz8uPPfmTi2iaHd3kTmi3AjKQVP/ABdJxjH/AAWKp1q/5D/m5pURlufLdxJHvvat Fdmg78bd5W/DFWDXFtcW0zwXMTwTxmkkUilHU+BVqEYqp4qjNI1jVdH1CLUdKu5bK+gNYriBijr9 I7HuO+Kvojyr/wA5eehoDxeZtJkvNbgAEE9oUjiuPEyhv7o+PBWB8BirCPOP/OTv5ka96kOnTR6B YvUCOyFZyv8AlXD/ABg+8YTFXk91d3V3cPc3c0lxcSnlJNKxd2J7szEk4qpYq+gP+cRPNv1TzJqn liZgItThF1ag1/v7bZlX/Xick/6mKvqzCrsVfKv/ADlr5FWx1ux84WkfGDVB9V1EgbC5iX90xPjJ EtP9hgVhH/OPfnc+VfzIsfWk4abq/wDuPvQfsj1SPRc12HCXjU9lrir7hwq8R/5yz8xGw/L210iN ysus3iLIn80FsPVf7pfSxV8g4FfZf/OLHl8ab+V8eoMoE2s3U1yWp8Xpxn6uin2rEzD54Vew4q7F WOfmP5nHlfyLrWvA0lsrVzbnr+/kpHDWvb1XXFX57u7u7O5LOxLMx3JJ3JOBXsf/ADi95Fj8wee2 1m8iEmn+XkW4o26m6kJFuD/q8Wk+ajFX2RhV2KuxVgH56+cL3yp+Wup6jp8jQ6jN6dpZzL1jeduL OD2Kx8ip8aYq+E3d3dndizsSWYmpJPUk4FVrGwv7+5W1sbaW7uX+xBAjSSN8lUEnFXpfln/nGv8A NTXOEk1hHo9s+/rajJ6bU6/3KCSYH5oMVeq+W/8AnD/QIOMnmLW7i9elTb2SLbxg+Bd/VZh8guFX qvlv8oPy18u8W0vy/arMtKXM6m5mBHcSTmRl/wBiRirMMVdiqS+ZfJXlLzPB6Ov6TbaivHiskyD1 UHX93KKSJ1/ZYYq8P85/84iaZPzuPKGqNZyGpWwv6yQ79lmQeooH+Ur/ADxV4L5x/LLzx5PlK69p M1vADRb1B6ts1elJk5JU+BNfbArF8VZF5U/Lzzr5sl4eX9IuL1K8WuFXhAp8GmcrGvTu2Kvb/J3/ ADiDcPwuPN+riJdi1hpw5NTwaeQcQfGiH54qlP8AzkT+SeieUtH0vXPK9q0OnRH6nqaF3lPNiWin ZnLH4jVW6D7NBirx/wAkeZZ/LHm3Sdfhry0+5SWRVNC8VeMqV/y4yy/Tir9DLW6t7u1huraQS29w iywyr0ZHAZWHsQcKquKsN/ODyknmr8uda0oJzuhAbmxoKsLi3/eRhf8AX48PkTir4FVmVgykhgag jYgjAr9A/wAr/Nf+K/IOi64zcri5t1W7O3+9EJMU2w6VkQke2FXzn/zl5rZuvPGlaQsnKLTbH1GT ss1zIS30mOKM4FeEYq/Q/wAh6L+g/JWhaSY/TksrG3imTofVEY9QmvcvUnCqe4q7FXiX/OWuqPa/ lvaWSEg6hqMSSAdDHFHJIa/7NUxV8gYFfZP/ADiroSaf+Vy6gVAl1i8nuOe1SkTfV1X5BomP04Ve x4q7FXYqwD89fKVz5o/LLVrCzRpL+3Vb20iWtXe3bmyAD7RaPkqjxpir4SwK+nf+ca/zc8oW2jx+ VNWS10fU4iRbX/FIUvFLEqssgCj1lrQcj8Qp3wq+i5rm3giM08qRQjrI7BV39ztirF9Y/Nn8tNHQ tf8AmWwUitY4plnk2/4rh9R/wxV575h/5y0/L2w5x6Ra3usSqfgdUFtAw/15f3o/5FYq8t80f85Y fmFqfOPRYLXQoCTxZF+s3AU9jJMPT+kRjAqZ/lj/AM5T65Y3aWHnljqOnSEAanHGq3EHarpGFWVP Hbl/rdMVfUWlatpmr6dBqWmXMd5Y3Kh4LiJgyMp9x+I7YVReKrZYoponimRZInBV43AZWB6gg7EY qwtPyU/KlNU/SY8s2X1rkX4lWMPI/wDLuT6P/CYqzOGGGCJIYUWKKMBY40AVVUbAADYAYqvxVK/N Hl3T/Mnl7UNC1BeVpqELQyGlSpP2XX/KRgGX3GKvz38w6HfaDrt/ot+vG70+eS3mp0JjYjktf2W6 g+GBX2H/AM4zecP0/wDlpbWU0nO+0JzYygmreiPjt2p4emeA/wBU4Ves4q7FX59fmd5eHl38wdf0 dE9OG2vJTbIe0Ep9WH/km64FfQP/ADh95iafy/rnl+RqmwuI7u3B68LlSjgeytDX5thV4t+feqnU /wA3PMc37MNwtqo8Pq0SQn/hkJwKxjybpX6X83aJpVARfX9tbtXpSWZUJNO1Dir9FMKuxV2Kvn3/ AJzEgZvK/l+evwx30iFfEvDUH/hMVfKuBX3P/wA48Mrfk35cKmo9O4FR4i7mB/HCr0XFXYq7FXYq +Zfz0/5xzvXvbnzR5LtzOk7GXUNEiX41c7tJbKPtBupjG9fs1GwCvm+SOSKRo5FKSISrowIYEbEE HpirmlkdVV3ZlTZASSB8sVW4qmeleV/MursF0rSby/LdBbW8s3av7Ct2xVkjfkn+aqaZcanJ5bu4 7S1QyzGTgkgQCpIhZhK1B1CqcVYRirOfyu/N7zL+X+pepZN9b0mZgb3SpWIjf/LQ7+nJTow+kHFX 2l5G8+eW/OuiJq2h3HqxbLcW70WaCSlfTlQE0P4HsThVkOKuxV2KuxV2Kvlr/nLjyP8AVdW0/wA5 WsdIdQAstRIHSeJawuT/AJcQK/7DArGf+cX/ADp+gfzDXSbiThYeYI/qrAkhRcpV7diO5J5Rj/Xx V9l4Vdir44/5yu0lbL80Rdr/ANLOwt7hz/loXt6f8DCuBWv+cU9ZNj+aP1En4NVsZ7cL/lx8bgH6 Fhb78VeZecb9tR83a3qDGpu7+6nJ2/3ZMzdtu+Ksn/ISwF9+b3lqEgHhcPcb/wDLvDJP7/77xV93 YVdirsVeT/8AOTugy6r+VF3NEKvpNzBf8e5VSYXp8knLfRir4rwK+vv+cS/MKX35fXWjs9Z9HvHA j/lguR6qH6ZPVwq9uxV2KuxV2KuxVjHmn8sfIPmqT1de0S2vLg9bkBopyKUoZoTHIQO1WxVILf8A 5x3/ACbt5RJH5cRmHaS5u5V/4GSZl/DFWUaZ5B8j6UVOneX9OtHXpJFawq/0uF5H78VT7FXYq+dv z0/5xzW/Nx5n8lWwW9+KXUNGjG0xJq0luvQP4oPtfs/Fsyr5ddHR2R1KupIZSKEEdQRgVPvJPnjz D5M12LWNDuDDOlFmhapiniqC0Uq7clNPmOoocVfcn5cfmHonnvy3DrOmtwl2jvrJiDJbzgVZG6VH dW/aH0gFWU4q7FXYq7FWMfmX5Pi84eR9W0Fgvr3MJazdqfBcx/HC1e3xqAfauKvgKCe90zUY54i1 vfWUyuh6PHLE1R8irLgV+hPkjzPb+afKWleYLcAJqFusroOiSj4ZU/2Eisv0YVTvFXzB/wA5kWIT UfK9+BvNDdwMd/8AdTROPb/dpwK8m/JbUX0/81vK86NxL38VsSDTa6rARt4iXFWGyyNJI8jfadix p4k1xV6f/wA4zgH849GqOkd3T/pFkxV9t4VdirsVQuq6baappl3pl6nqWd9DJb3CfzRyqUYfccVf nx528q3vlTzVqXl+93msJjGslKepGfiikHs8bK304Fa8seYPN+lXTxeWb69tLq84pJHYPIskvGvE ER7tTkaYqznSvzt/OvyheR/pK7u54nPM2WsxO4kX2eQLMB/quMVfUH5U/m1oX5h6RJcWiGz1O0ot /prsGaMt0dGFOcbdmoN+owqznFXYq7FXYq7FXYq7FXYq7FXi/wCd3/OP+n+bYbjXvLsaWnmhQXli FFivaD7L9ll2+F+/RvEKvkC7tLqzuprS7he3urd2jngkUq6Opoysp3BBwKyn8svzJ1ryD5jj1XTy ZbWSkeo2DMRHcQ+B8GWtUbsfaoKr7m8pebdC82aFb63olwLiyuB8njcfailX9l17j6RtQ4VTjFXY q7FXYq+K/wDnJXyV/hz8x7i+gj4afrwN/CQPhExNLla+PqfH/shgV6V/ziH5x9fTNW8o3D1ks2/S FiD19GUhJlHgFk4n5ucKvorFXzh/zmV/vF5U/wCMl7/xGDAr588k3RtPOegXYf0zb6jaSh6V48J0 atN+lMVSXFXp3/ONcqp+cuhqf92LdoD7/U5W/hir7ewq7FXYq8N/5yA/Pifyk58seW2A8wSIr3l6 QGFpHIKqqqagysvxbiirTqTsq+a/KXlDzb+YXmc2Wnh73ULljNe31wzMsak/HNPKeR6/STsKnAr7 R/LH8pvLP5f6X6GnJ9Y1OZQL7VZVHrSnYlV/kjqNkH01O+FWQeaPK2heaNGuNH1q1W6srhaFWHxI 3Z426q69iMVfGflW6v8A8r/ztjszOxhsdQ/R964FPWs5nClivvGyyAfzAYFfcOFXYq7FXYq7FXYq 7FXmf56fm1d/l3odjNp1pFd6pqUzx24uA5hRIlDSMwQozH4lAHIda9sVY9+TP/OR1v5wv/0F5lht 9M1uZv8AQJYOS21xX/dQEjOySeALHl2odiq9txV4v+fX5ExecIJPMOgIsfmeBB6sNQqXkaCgU12E qgUVu/Q9iFXx/cW89tPJb3EbQ3ELGOWKQFXR1NGVlO4IPUYFZj+Vv5qa9+X2t/XbH/SdOuKLqOmO xWOZB0INDwkX9l6feKjFX2v5I89+WvOmjJquhXImi2E8DUWaCQivpyp+yfwPYkYVZBirsVdiryD/ AJyf8n/p38uJNSgj53ugSi7UgEt6DfBOBTsAQ5/1cVfMX5R+bz5T/MLRtYd+Foswgvien1af93KT /qhuY9xgV9+YVfM3/OZN9GZvKtgpHqIt5PIO4VzCid+/BsCvnfR5RDq1lMRUR3ETkePFwcVUr23N te3FuRQwyPGQSCRwYjqPlirKvyf1Eaf+aPle5LBVOowQsxoABO3omta9nxV9+YVdirsVfnR5s1i7 1rzPqurXbFri9u5pnqa05uSFHso2HtgV9t/kh5R0ry3+W+irZIpn1K1hv765A+KWW4jEm57qgbgv sPnhVnmKpb5h8x6L5d0mfVtau0s7C3FZJZD1PZVA3Zj2UbnFXw5NeXf5jfm6tzDAY5Ne1OP04epj hLhRyI/33EtWPsTgV964VdirsVdirsVdirsVYr+ZP5d6L588tS6PqQ9KUH1LC9UVe3nAoHA2qp6M vceBoQq+GvOPk/X/ACZ5jn0bV4/RvbYh4pYyeEiE1SWJtqq1Nu46GhGBX0h+Qv8AzkGNbNv5V83T hdXoItN1RzQXVNhFMT0m/lb9v/W+0Ve/4q8g/Or8gtN87RSazoojsfNCLVnPwxXYAACTU+y4A+F/ obahCr5A1zQtX0LU59L1e0ksr+3PGWCUUYeBHYqexGxwKifK/m3zH5W1RNU0G+ksbxdiyGquta8J EaquvswxV9GeTP8AnLvSZoUt/N+mSWtyKA3tgPUhb3aJ2Dp9BfCrO5P+clfyaWEuuus7UB9JbO85 b9vihC/jiqQ3/wDzlt+WtuGFraaneOPslYYo0PzLyqw/4HFWC+av+cubnUdOudP0zyzAkN1G8MzX 87Tq0ci8WUxRLD+yT+3gV8+RRyTTJFEheSRgqRoCSSxoFUbmuKv0f0pJY9Ms45kMcyQRrJGW5FWC AEcgBWh74VfGX/OTHmVda/NS9giYNb6PDFp8ZHQslZJfpEsrL9GBXlkUjRyJIv2kYMK+INcVZJ+Z +m/o38xfMtkF4pFqV0Yl8I3lZ0/4VhirHrO6mtLuC7gPGa3kWWJvBkYMp+8Yq/RzR9Sg1TSbLU7f +4vreK5i7/BMgdfwbCqLxV2Kvz9/NLync+VPPusaPMhWKO4eWzY9Htpj6kLAjY/A1DTuCO2BXt/5 A/n/AKBYeX4PKnm26Fi9gPT0zUpATE8NfhilIB4NHWisfhK+BG5V6J53/wCciPy58t6c8tlqEOu6 iRS3srCRZFLU6yTLyRF336nwBxV8l+f/AMyfNXnrVTfa3c8okJ+qWMdVt4FPaNKnfxY1Y+OBUl0T XdZ0S9F7o91JZX3ExpcwnjKocUbg4+JSRtVd6bYqzOHz/wDnp5f9PU5tU1yGAmscuofWJrdq+10H jOKvePyU/wCci4vNl5D5d8zRx2euyClpeR/BBdMP2CpPwSnsK0btQ0BKvcsVdirsVdir5Ksf+cqP Pdn5zll1m3jfQRcPHPo6xJHNDGGK0WQ/GZE78jQnbbsFfUnl7zDo/mLR7bWNHuVu9Pu15xSp+KsO qsp2ZTuDhVjf5qfldon5gaA1ldqIdTtwzaZqIHxwyEdG8Y2/bX6eoGKvh7zP5Y1zytrlxo+sW7Wu oWrbj9ll/Zkjb9pW6gjAr6U/ID8/xq4t/KXm24pqwpFpeqSn/enssMzH/d38rft9D8X2ir6CxVjH nr8t/KPnewFpr9kJXjBFvex0S5hr/vuSh2/yTVT3GKvkP85PyW1H8ubm1mF4uoaPqDulpccSkqMg DcJl3WtG2Kneh2GBXm2KuAJIAFSdgBirItG/Lnz7rQVtL8v391G/2Zlt5BF/yMYBPxxVn+g/84r/ AJpaiQb+O00eLqTcziR6ey24m3+ZGKvbPyz/AOcbPKvk+/g1i/uX1rWrZg9tJIgit4XHR0iq5Lqe jMx8QAcKvTfMuuW2g+XtS1q53g062luXWtOXpIW4j3YigxV+dmoX91qF/c3925kuruV57iQ9WklY u5+knAqhir1z/nKPRG07817m740j1a1t7tKdKqn1dvprBU/PFXkeKvtf/nGjzOut/lZY27vyutGk ksJhXfih9SE08PTkVR8jhV6rirsVeefnB+Tmj/mHpakstlr9opGn6jxqONa+jMBu0ZP0qdx3BVfJ vmf8lfzM8uXMkV5oVzcwofhvLGNrqBhWgbnEG418HCn2wKxbUtC1vS1ibU9PubFZ+QgNzDJDz4U5 cOYXlx5CtOlcVUtM0zUNUv4NP063e6vrpxHb28QLO7HoABir7A/JT8gNN8nQxa1r6R3vmhwGQGjx WdQDxj6hpB3k+hfFir2C4t4LmCS3uI0mglUpLFIoZGVhQqymoII7HFXxP+ffkO18hfmDGdDLWthe xpqGnqjHlbyByrIjdfhdOS+AI8MCvrn8uvMr+Z/I2ia7LT1761R7njQD11+CagHQeorYVZFirsVd ir58/wCcjPyOGqxT+c/LVv8A7k4lMmsWMY/3oRRUzoP9+KB8QH2hv9r7Srxf8oPzf1j8vdYqOV3o F2w/SOnV+j1Yq7LIo+hhsexAV9teXvMOj+YtHttY0e5W70+7XnFKn4qw6qynZlO4OFWJfm9+Umk/ mFoYhcra63aBm0zUKV4k9YpabmJ+/cHceBVfEfmHy9rXlvWrnSNXt2tNRs34yxt96srDZlYbqw6j Ar6V/IX/AJyEj1JLbyp5wueOpjjFpmqyna4HRYp2PSXsrn7ff4vtFX0Liryz/nJjTLS9/KHVJpyF ksJba5tiaf3nrLD+KTMMVfLX5Mak1h+aPlt6K0dzexWc0bgMrJdH0SGUgg/bqPffAr7ttNH0izcy Wljb27kli8USISW2JqoG5wqi8VdirsVeM/8AOVfmU6Z+Wy6XE/GfW7qOBl7mCH99IQf9dEB+eKvj nAqc+S9IfWfN+i6Ug3vr63gJ3oFeVQxNN6AbnFX0d/zmB5bM+g6J5jiSrWM72Vyw68LhecZPsrRE fNsKvljAr23/AJxU86Lo/nifQLmTjZ6/EEi5GgF1BV4uv8yF19zxxV9f4VdirsVdir4v/wCco9Yu b782byzkb91pVtbW0C9ABJELlj9LTnAr0r/nEXylo48v6l5qeNZdWe7ewilYAmGGOON2CeBkMvxe wGFX0NiqncXFvbQSXFzKkNvCpeWaRgiIiirMzGgAA6k4q+Jv+chPzE07zr54EmlESaVpcIs7W5oR 6x5F5JBX9ks1F9hXvgVN/JH/ADkxrflHyxpnl200W2uLXT0ZTLLLJ6kheVpGPwgKv26DY/Tir2T8 vf8AnJvyZ5ovItN1SF9A1OYhYRPIsltIx6Ks9E4sfB1A8CThV7FirsVdir5a/wCcjPyMOnyXHnTy xb/6BITJrOnxAn0XJJa4jA/3Wf2x+yd/s/ZCvPfyZ/ODUvy91oiQPd+Xr1gNRsQd1PT14QTxEij/ AIIbHsQq+2dE1vStd0q21bSblLvT7tBJBPGdiPA9wQdiDuDscKsI/OP8nNJ/MHSeacLTzFaIRp+o EbEdfRmpu0bH6VO47gqvifXdD1bQdXudI1a3e01Gzf054H6g9QQRsQwIKkbEbjAr6Y/5x3/PZtUS Pyh5qua6jEh/RepSn++jjUsYpnJ/vFUVVj9odfi+0VYb/wA5IfnPZeaJ4/K3l6cTaJZSere3ifYu bhdlEZ7xx1O/Rm36AEhWG/kD5cuNc/NXQ1jWsOnSjUbl6VCJa0dSfnJwX6cVfdOFXYq7FXYq+O/+ cqvNw1f8wY9Ggk52ugQCFgDVfrM9JJiP9j6an3XArxfFXs3/ADir5WOq/mO2rSR8rXQrZ5+RFV9e cGGJT78Wdh/q4q+oPzL8qjzX5E1rQQoae7t2NpXYfWIqSQ79v3iLX2wq/Pp0dHZHUq6khlIoQR1B GBVfT7+806/ttQspTDeWkqT28y7MkkbBlYfIjFX6Bfl75ys/OPlDTfMFtxU3cQ+swqa+lcJ8M0fU n4XBpXqKHvhVkWKuxV2Kvkj/AJy08pXVj50tfMqITY6xAkTydlubYcCp8KxcCvjv4YFST8gPzkg8 hapc6frPNvLuplWmeNeTW867CYKN2Urs4G/QjpQqvpDU/wA/vymsNMa//T8N2OPKO1tQ0lw57KI6 KVP+vQeOFXy9+a355eZ/Ps7WlTpvl5GrDpkTH46Goe4cU9Rvb7I7Cu5Cph+S35D6r55uE1XVBJY+ Vom+KenGW6K1BS3qKcQRRn6DoKmtFX0q/wCQv5Rtp/1H/DduIqU9UNKJulK+tz9Sv+ywq+XPzw/K GT8vdcgNpK9zoOpc2sJpKGRGSnOGQgAEryBDU3HyOBX0B/zjP+Yl75r8nT6bqcrT6poLpC07mrSW 8oJgZierDgyk+w74VSP88v8AnIDzL5L82ReX9Bs7Y+hFHcXdzdq8nqGSpCIqslFA6nrXwpuq9D/K f82NE/MHRPrFvS21e2AGpaaTVo2O3NK/ajbsfoO+Ks5dEkRkdQ6OCrKwqCDsQQcVfIH/ADkD+Rr+ U7uTzJ5ehLeWrl/39ugJNlKx6Hr+5Y/ZPY/D4VCsf/JT85tQ/L/VTb3Qe68tXrg31oDVom6evADt zA+0P2ht1AIVfaukavpmsaZbanplyl3YXaCS3uIzVWU/qI6EHcHY4VeXf85E/lfo/mXyhf8AmGON YNe0O2kuY7ofD6tvADJLDL/MOAYp4N7E4q+L8Cqlvbz3M8dvbxtNcTMI4oowWd3Y0VVUbkk9Bir7 V/IL8pv8CeW2utSRT5j1YLJfdD6EY3S3Vv8AJrV6bFvEKDhV6nirsVdiqT+cfM1n5Y8r6nr95T0N OgaXgTTm/SOMHxdyqj54q/PTVNSvNU1K71K9kMt5ezPcXEh/aklYsx+84FQ2KvtL/nGbyWfL35cQ 39xHwv8AX3+vScgQwgpxt137cP3g/wBfCr1rFXxL/wA5G+Rm8sfmLdXMEXDTNcrf2hA+ESOf9IjH b4ZDyoOisMCvLcVe1f8AOMv5oL5a8yt5c1ObhouuOqxOx+CG8+zG/sJRRG9+J6DFX2FhV2KuxVJP OXk7QvN+gXGh61D6tpPurLtJFIteEsbb8XWu33GoJGKvkbz1/wA42/mH5du5G0y0bX9Lr+5ubJeU 1CTQSW4JkDePHkvvgV53q3lTzTo0Ql1jR77TYiwjEl3bTQKXYFgtZFUVIUmntirO/wDnH38tLHzz 5yddVBfRtKjFzeQAkGZi3GKIkdFY1Lewp3rir7YtbW2tLaK1tYkgtoEWOGGNQqIiiiqqjYADoMKq uKvnP/nMDzHpf6K0Xy4rK+p/WDfyKN2ihWNol5eHqM+3+riqR/8AOHUVwfMXmKVQ31ZbOFZCPs82 lJSvvRWpgV69+dX5OWH5g6QstuUtfMdihGn3hFFdftehMQK8Ceh/ZO/cglXx9p2pebfy/wDNxmgM mma7pUpjmif2+1HIvR0cfQRuOxwK+0fyn/NjRPzB0T6xb0ttXtgBqWmk1aNjtzSv2o27H6DvhVml 5Z2t7aTWd3Es9rcI0U8Mg5I6OOLKwPUEHFXxb+ef5L3fkPVf0hpytN5XvpD9Vl3Y27nf0JWP/CMf tD3BwK1+SX523n5f3ktlqCy3nlm65STWkXFpYpuO0kIdkX4qAOCd+vUYqmX5tf8AOR+sec9Ok0PS LQ6TokxpdFn53FwoNQrlaKieKitfGm2KvNPJ/k7X/N+uRaLoVv8AWL2VWc8iEREQVZ3c7Ko/XsNz ir64/J7/AJx+0XyMU1bU3TVPM1KLcAH0LYEUIgVgCWPeRhWnQLvUq9axV2KuxV2Kvl//AJyz/MQX F3a+R7CSsdqVvNXKnrKy/uYT/qK3M/NfDAr5zxVl/wCU/kWbzt540/RQrfUuXr6lKtfgtYiDJuOh bZF/yiMVffUMMUEKQwoI4olCRxqKKqqKAADoAMKr8Vebfn7+XR86eRJ1tIy+taVyvNMC/acqP3sP /PRBsP5guKvhzArsVfY//OO35wr5u0VfL+s3HLzLpkdBJIfiu7ddllr3kTZX7n7Xc0KvZcVdirsV dirxP/nLTR5rz8t7a+hRm/RmoRSTkbhYpUeIsf8Ano6D6cVeK/8AOOX5i6d5N86yR6s4h0rWYhaz XJNFhlVuUUjmn2Oqnw5V7YFfakUscsaSxOJIpAGR1IKspFQQR1Bwq8P/ADk/5yQ03y562h+UpItQ 12hSe+FJLa1boQP2ZZR4fZU9a7rir5O1PU9R1S/n1DUbmS7vbli89xMxd3Y9yTgV7f8A84tfmVov l/VbryxqkaW/6bmRrTUtwTOo4JBLU0CtU8DT7RIPUUVfWmFXlX54/knY+e9MbUtNRIPNVpH/AKNN sq3KLv6Ep6f6jHofbFXyJo2s+aPI/mhbyzaXTda02Vo5YpFKkFTR4pUPVT0ZTgV9s/lR+aej/mD5 fF7b8bfVLeianp3KrROejL3Mb/st9HUYVZH5o0nR9X8u6jputBDpVzbut20lAqIBUyVbZSlOQbsR XFX50yKiyMqNyQEhW6VAOxwK9Y8i/wDONXn/AMz29nqNyYNI0a9ijuIbuZ1lkeCVQyvHDEWNSrVo 5TFX1J+XH5YeWPIOkmy0eIvczUN9qMtDNOw6VI2VRX4UGw9zUkqy7FXYq7FXYqxb8zPPth5G8oXm u3XF5kHpWFsxp61y4Ppp8tizf5IOKvgXVNTvtU1K61K/lM97eSvPcTN1Z5DyY/ecCobFX2n/AM46 flifJ/lD9I6hFw17Wwk9yrD4oYAKww+xoeb+5ofs4Ves4q7FXYq+N/8AnJP8rj5W80HX9Nh46Drc jPRRRILs1aSLbYK/20/2QH2cCvG8VRuia3qmh6ta6tpVw1rqFnIJbedOoYeIOxB6EHYjY4q+4fyg /NnSvzC0H10C22t2gCanp/IEq1P72PuYn7eB2PiSrPsVdirsVQOu6Lp2uaPeaPqUXrWN9E0FxH0J VxSoPZh1B7HFXwz+aH5S+ZfIOrSQ3kTXGjyOfqGrIp9KRKnirkVCSU6ofoqN8CsZtvM/mS1099Nt tWvINOk/vLKO4lSBq+MasEPXwxVV8reUvMPmrVo9K0Kye8vJNyFFERe7yOfhRR4nFX1/+Wv/ADj3 5R8raJNDq8EWtavqELQ6hdSqTGscgo8VuDQov+Xsx9ugKvmv85Pym1H8vvMBROc+g3jM+l3xHbqY ZCNhIn/DDfxACvbv+cfvz7i1uG38p+arjjrcYEenajK212o6RyMf93AdD+3/AK32ir3zFXi3/ORv 5S6L5g8u3fmy3eKw1zSYDLPcOQkdzBEv91If9+DpG3+xO1OKr5V8o+btd8pa7b61olwYLyA0IO8c iH7Ucq1HJG7j6RvQ4FZl5/8A+cgfP/nTTm0u6kg03S5Nri1sFeP1h4Su7yOV/wAkEL4g4qkP5Z/l zrPnvzLBpdjGy2asralfU+C3hruxPTkwBCL3PtXFX3zY2VtY2VvY2qCK1tYkhgjHRY41Cqv0AYVV sVdirsVdiqjeXlrZWk15dyrBa26NLPNIeKIiDkzMT0AAxV8O/nZ+alx5/wDNDSwFo9B08tFpVu2x KmnOdx/PLSvsKD3wK87xV7f/AM42/lC3mTWE81azBXQdMkraxSCq3V0hqBQ9Y4ju3Ymg/mxV9e4V dirsVdiqT+b/ACppPmvy7eaDqsfO0vE48hTlG43SRCejI24xV8F+e/JOseS/M11oOqpSWA8oJwPg mhb+7lQ+DD7jUHcYFY/iqaeWfM+ueWdZg1jRLprS/tz8Ei0IKn7SOpqrK3cHFX2l+UX50aD+YGni ElbHzFAlbzTCftUArLAT9qMk9Oq9+xJV6NirsVdiqldWtrd28ltdQpcW8o4ywyqHRh4MrAgjFWG3 H5JflPPcNPJ5YshIx5EIhjSvsiFUHyAxVlGjaBomiWYs9HsLfTrUGvo20SRKTSnIhAKnbqd8VR+K pX5n8saJ5n0S50XWrZbmwuVo6HZlYfZdG6q6ncEYq+LfzX/JXzL5AvmuAr33l93/ANF1WNTRan4U nA/u38OzdvABWUeQv+cqPN2gWaafr9qPMNtEOMNxJKYbtQBQB5eMgkH+svLxbFUj/Nn8+vMX5gRJ pcNsNK0JXVzYxuZZJpF+yZZOKcgDuqBaV8SAcVek/lb/AM4zaLqvkVLnznb3Fpq99L9YtWt5DFPB bMihEkVw8fJiC1ClRUdDUYVZXp3/ADid+VtpcrNPJqWoRqQTb3NxGsZp2Jgigff2bFXqugeXNC8v acmnaJYw6fZJuIYFCgtSnJj1ZjTdmqTiqY4q7FXYq7FWmZUUu5CqoJZiaAAdSTir5G/5yF/PI+Z7 iXyr5dm/5123el5dodryRDUAEf7pRht/Md+wwK8NxV6B+Tv5S6n+YOviI87fQrNlbVL4D9mtfRiJ BHquOngNz4FV9w6RpOnaPpltpemwLbWFnGsVvAgoFRR+J7kncnc4VReKuxV2KuxV2KsC/OD8qdM/ MHy6bZitvrVmGfSr4j7DkbxyU39OSgDeHXtQqvh/XdC1bQdWudI1e2e01C0fhPA/UHqCCNmVhurD YjcYFQGKojT9QvtOvYb6wuJLW8t2EkFxCxSRGHQqwoRir6k/KT/nJ7TtTWHRvO7pY6jskOsUC28x 6fvgNoW/yvsH/Jwq9/R0kRXRg6OAyspqCDuCCMVbxV2KuxV2KuxV2KrJ4ILiGSCeNZoJVKSxSKGR lYUKsp2IOKvLdf8A+cZvyo1e6NzHZT6W7EtImnzenGxP/FcglRfkgAxVMPJn5Bflr5TvU1CysHvd RhblBd37+s0Z6gogCRBh2bhyHjir0XFXYq7FXYq7FXYqo3l5aWVrLd3kyW9rApkmnlYIiIu5Zmag AGKvkr88v+chLjzO03l3ytK9v5dBKXV4KpJejoRQgMkP+Sd2706YFeHYqz78pvyh178wdWCwhrXQ 7ZwNR1MjZR19OIH7chHbt1Puq+2vLHljRPLGiW2i6LbLbWFstEQbszH7Tu3VnY7knCqaYq7FXYq7 FXYq7FXYq86/OP8AJzSfzB0nmnC08xWiEafqBGxHX0ZqbtGx+lTuO4Kr4p8xeXda8uaxcaPrNq9n qFq3GWF/wZWGzKw3DDY4FS7FXYq9G/LT89fOnkZo7WKX9JaGCOWlXLEqq1qfQk3aI/Kq+KnFX1J+ X355+QvOqRw212NP1dtm0u8Kxylv+Kmrwl9uJ5eKjCr0LFXYq7FXYq7FXYq7FXYq7FXYq7FXYq7F WLefPzL8o+R9P+ta7eBJnFbawio9zN1/u46jbb7TUUeOKvkH81fzt80ef7g28p/R+gxtyt9KiYkE jo877eo//CjsOpIV51ir2X8nv+cdtZ83NBrHmASaZ5bNHQH4bi6Xr+6B+wh/nP8Asa9Qq+utF0XS tE0u30rSbVLPT7VeEFvEKKo6n3JJ3JO5O5wqjcVdirsVdirsVdirsVdirsVYd+ZX5V+WPP8ApX1X VI/RvoQfqOpxAetCT2/y0P7SHb5HfFXxr+Y35Vea/IWo+hq0HqWMjFbPU4gTbzDqBy/ZenVG3+Y3 wKw7FXYq7FXpPkn/AJyC/Mnyqsdul/8ApXTo9hZaiDMAoFKJLUSqAOgDcR4Yq9z8o/8AOWHkXUwk PmC2n0K6OzSUNzbf8HGPUG/jHt44VevaH5m8u69bC50XUrbUYaAlraVJONezBSSp9jiqZYq7FXYq 7FXYq7FXYq7FWP8Amzz/AOTvKdv63mDVYLEkckgZuU7j/IhTlI30Lir58/MD/nLTULpZLLyVZmxi YFf0peBXn+ccILRp82LfIYFfP+p6pqWqX0t/qV1LeXs55TXE7mR2PuzVOKpj5U8l+Z/NmojT/L+n y31xt6hQUjjB/akkaiIPdjir6k/K3/nGTy/5daHVPNDR61rK0ZLalbOBh0orCsrDxcU/ye+FXt2K uxV2KuxV2KuxV2KuxV2KuxV2KuxVC6ppWm6rYTafqdrFeWNwOM1tOgeNh13VqjY7jFXzf+Zv/OKU qGXUvIcnqJuz6Jcv8Q9reZuv+rIf9kemBXzxqukappF9JYapaTWN7EaSW9wjRuPD4WAND2xVCYq7 FXYqrWl7eWVwlzZzyW1xGaxzQu0bqfEMpBGKvQfL/wDzkN+bOihUXWm1CBd/S1BFuSfnKw9b/h8V eiaL/wA5i6sgC635dguCftS2U7wU9xHKJ6/8HirMdP8A+cufy6nVReWGp2kh+1+6hljHyZZeR/4H CrIYP+clvyalTk+uPAa04SWd4T8/gicfjiqu/wDzkX+TKornzGtG6AWt4T9IEJIxVJ9Q/wCcqfyo ta+hLfX1K0+r2xWtK9PXaHFWG65/zmLbhXTQvLjs3+6576cKB84og1f+RmKvM/M3/OR35ra6GjXU xpNs3+6dNT0CPlMS84+h8CvNbi4uLmZ57iV5p5DyklkYs7E92Y1JxVNvK/krzV5qvBaeX9Mn1CWo DtGv7tK95JWpGg92YYq9/wDIP/OJESGK987X3qdG/RNixC+PGW4IB9iIwPZsKvoPQ/L+iaDp8ena NYw2FlH9mCBAgrSnJqbsxpux3OKphirsVdirsVdirsVdirsVdirsVdirsVdirsVdiqR+a/JHlXzZ Y/UvMGmw38QB9N3FJY69THKtHQ/6pxV4F50/5xDlUvc+TtVDruRp+o7H5JPGtD7BkH+tgV4h5o/L fzz5Wdxrui3NpEhobnh6luflPHziP/BYqxvFXYq7FXYq7FXYq7FXYqyHQPy988+YeJ0bQr28jY0E 6QsIQT4ysFjH0tir0/y1/wA4l+fr9kfW7u00WA/bTl9anHySIiI/8jcVeveU/wDnF/8ALXRDHNqM U2u3aUJa8bjByBrVYI+II9nLYVer2NhY2FrHaWNvFaWkQpFbwIscajwVFAUYqr4q7FXYq7FXYq7F XYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq5uPE8qcab16UxV4559/6Fi5v/iL9EfWv92fUOX1iv8A l/UP3lf9bFXg3mj/AKFy/efoP/EXrVPp+n9X+r0/57/vflgV5zf/AKL9T/cf6/p1P+9HDlTt9jFU LiqrbfVOR+s+pxp8Pp8a19+WKss8v/8AKoOS/wCIP8QU/a+o/UutB/v3tXFXp/lb/oUbb659e9T9 n9KfWuu3X6n+7+/+mKvafJn/ACoj91/hb9A/WP8AdfpfV/rX08/3/wB+FXoeKuxV2KuxV2KuxV2K uxV2KuxV2KuxV2Kv/9k= xmp.iid:BE7FB6CF34EBE311A1FEE7E15CD05098 xmp.did:BE7FB6CF34EBE311A1FEE7E15CD05098 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf xmp.iid:BD7FB6CF34EBE311A1FEE7E15CD05098 xmp.did:BD7FB6CF34EBE311A1FEE7E15CD05098 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:BD7FB6CF34EBE311A1FEE7E15CD05098 2014-06-03T17:36:20+02:00 Adobe Illustrator CS6 (Windows) / saved xmp.iid:BE7FB6CF34EBE311A1FEE7E15CD05098 2014-06-03T17:36:29+02:00 Adobe Illustrator CS6 (Windows) / Print Adobe PDF library 10.01 }ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw $}ICC_PROFILE{od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B}ICC_PROFILE3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQ}ICC_PROFILEDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKl}ICC_PROFILELnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 }ICC_PROFILE E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ }ICC_PROFILE K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:}ICC_PROFILE 7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_ki}ICC_PROFILE kvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht}ICC_PROFILE ! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: }ICC_PROFILEuGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhw}ICC_PROFILEgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=}ICC_PROFILEN=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dh}ICC_PROFILEjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+R